جداسازی سویههای استافیلوکوکوس اپیدرمیدیس مقاوم به متیسیلین حاوی ژن arcA تولیدکننده انتروتوکسینهای A، B، C، D، E، G، H و I از عفونتهای بیمارستانی در اصفهان، ایران
محورهای موضوعی : میکروبیولوژی
پریسا بهشود
1
*
,
الهه تاج بخش
2
1 - گروه میکروبیولوژی، دانشکده علوم پایه، دانشگاه آزاد اسلامی، واحد شهرکرد
2 - گروه زیست شناسی دانشگاه آزاد اسلامی واحد شهرکرد
کلید واژه: ژن mecA, انتروتوکسینها, الگوهای حساسیت آنتیبیوتیکی,
چکیده مقاله :
چکیده زمینه: استافیلوکوکوس اپیدرمیدیس انواع مختلفی از سموم پروتئینی خارج سلولی از جمله انتروتوکسینهای استافیلوکوکی را تولید میکند که به عنوان سوپرآنتیژن عمل میکنند و میتوانند شرایطی را برای حمله به سلولهای میزبان فراهم کنند. هدف از مطالعه حاضر، تعیین الگوهای مقاومت آنتیبیوتیکی و شناسایی ژنهای انتروتوکسین شایع در سویههای MRSE حاوی ژن ACME-arcA در اصفهان بود. روشها: این بررسی بر روی 150 ایزوله استافیلوکوکی بهدستآمده از عفونتهای مختلف بیمارستانی انجام شد. سویههای MRSE با روش PCR جداسازی شدند. الگوهای ضدمیکروبی ایزولههای MRSE با روش انتشار دیسک تعیین شد. در نهایت، ژنهای انتروتوکسین در سویههای MRSE حاوی ژن ACME-arcA با استفاده از سیستم PCR شناسایی شدند. نتایج: از 150 عفونت بالینی، 100 سویه استافیلوکوکوس اپیدرمیدیس جداسازی شد. از بین 100 سویه استافیلوکوکوس اپیدرمیدیس، 65 (65٪) ایزوله MRSE بودند. از این تعداد، 33 جدایه (50.7%) هر دو ژن mecA و ACME-arcA را داشتند. الگوهای ضدمیکروبی جدایههای MRSE در این مطالعه نشان داد که جدایههای MRSE بالاترین میزان مقاومت را به اریترومایسین (81.5%) و کلیندامایسین (64.6%) نشان دادند، در حالی که کمترین مقاومت را به ریفامپین (7.6%) و لینزولید (1.5%) نشان دادند. علاوه بر این، فراوانی ژنهای انتروتوکسین sea، seb، sec، sed، see، seg، seh و sei به ترتیب 60.6٪، 63.6٪، 66.6٪، 15.1٪، 6٪، 72.7٪، 0٪ و 75.7٪ در جدایههای حاوی ژنهای mecA و ACME-arcA گزارش شد. نتیجهگیری: تنوع انواع ژنهای انتروتوکسین و شاخص مقاومت در بین ACME-arcA کدکننده MRSE باعث نگرانی در مورد سلامت عمومی میشود؛ بنابراین گزارش سریع و دقیق وجود ژنهای انتروتوکسین از عفونتهای بیمارستانی ضروری است.
ABSTRACT Background: Staphylococcus epidermidis produces various types of extracellular protein toxins including staphylococcal enterotoxins that act as superantigens, and can provide conditions to attack host cells. The goal of the current study was to determine antibiotic resistance patterns, and detection of prevalent enterotoxin genes in MRSE strains containing the ACME-arcA gene in Isfahan. Methods: This survey was done, on a total of 150 staphylococcal isolates acquired from different nosocomial infections. MRSE strains isolated by the PCR procedure. The antimicrobial patterns of MRSE isolates were determined by the disk diffusion procedure. Finally, enterotoxin genes in MRSE strains containing the ACME-arcA gene were detected by using the PCR system. Results: Out of 150 clinical infections, 100 Staphylococcus epidermidis strains were isolated. Among 100 Staphylococcus epidermidis strains, 65 (65%) isolates were MRSE. Of these, 33 isolates (50.7%) had both mecA, and ACME-arcA genes. The antimicrobial patterns of MRSE isolates in this study showed that the MRSE isolates exhibited the highest rates of resistance to erythromycin (81.5%), and clindamycin (64.6%), while they showed the lowest resistance to rifampicin (7.6%), and linezolid (1.5%). Moreover, the frequency of enterotoxin genes sea, seb, sec, sed, see, seg, seh, and sei was reported 60.6%, 63.6%, 66.6%, 15.1%, 6%, 72.7%, 0%, and 75.7% respectively, in the isolates containing the mecA, and ACME-arcA genes.Conclusion: The variety of enterotoxin genes types, and resistance index among ACME-arcA encoding MRSE are causes for a public health concern; so rapid and accurate reporting of the presence of enterotoxin genes from hospital infections is essential.
References 1. Gordon RJ, Miragaia M, Weinberg AD, Lee CJ, Rolo J, Giacalone JC, et al. Staphylococcus epidermidis colonization is highly clonal across US cardiac centers.Int J Infect Dis. 2012;205(9):1391-8.doi: 10.1093/infdis/jis218. 2. Aghazadeh M, Ghotaslou R, Rezaee MA, Moshafi MH, Hojabri Z, Saffari F. Determination of antimicrobial resistance profile and inducible clindamycin resistance of coagulase negative staphylococci in pediatric patients: the first report from Iran. World J Pediatr. 2015;11(3):250-4.doi: 10.1007/s12519-014-0524-7.3. Halaji M, Karimi A, Shoaei P, Nahaei M, Khorvash F, Ataei B, et al. Distribution of SCCmec elements and presence of Panton-Valentine Leukocidin in Methicillin-Resistant Staphylococcus epidermidis isolated from clinical samples in a University Hospital of Isfahan City, Iran. J Clin Diagn Res. 2017;11(7):DC27. doi: 10.7860/JCDR/2017/25518.10258. 4. Lindgren J, Thomas VC, Olson M, Chaudhari S, Nuxoll AS, Schaeffer C, et al. Arginine deiminase in Staphylococcus epidermidis functions to augment biofilm maturation through pH homeostasis. J Bacteriol. 2014;196(12):2277-89. doi: 10.1128/JB.00051-14.5. Danesh M, Rahimi F, Arabestani MR. Antibiotic resistance pattern of Staphylococcus epidermidis strains isolated from a referral hospital in Isfahan. J Clin Infect Dis Trop Med. 2016; 20(71): 25-31.6.Wang PJ, Xie CB, Sun FH, Guo LJ, Dai M, Cheng X, Ma YX. Molecular characteristics of methicillin-resistant Staphylococcus epidermidis on the abdominal skin of females before laparotomy. Int J Mol Sci. 2016;17(6):992. doi: 10.3390/ijms17060992.7. Shamansouri S, Zadeh V, Khazaei M. Study on the percent of frequency of ACME-Arca in clinical isolates resistant to methicillin-Staphylococcus epidermidis in Isfahan, Iran. J Fundam Appl Sci. 2016;8(2):1046-57.http://dx.doi.org/10.4314/jfas.v8i2S.1198.Deplano A, Vandendriessche S, Nonhoff C, Dodémont M, Roisin S, Denis O. National surveillance of Staphylococcus epidermidis recovered from bloodstream infections in Belgian hospitals. J. Antimicrob. Chemother.2016;71(7):1815-9. doi: 10.1093/jac/dkw086. 9. Ertas N, Gonulalan Z, Yildirim Y, Kum E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique.Int J Food Microbiol. 2010;142(1-2):74-7.doi: 10.1016/j.ijfoodmicro.2010.06.002.10. Fisher EL, Otto M, Cheung GY. Basis of virulence in enterotoxin-mediated staphylococcal food poisoning. Front Microbiol. 2018; 9: 436.doi: 10.3389/fmicb.2018.0043611. Karimi M, Esfahani BN, Halaji M, Mobasherizadeh S, Shahin M, Havaei SR, et al. Molecular characteristics and antibiotic resistance pattern of Staphylococcus aureus nasal carriage in tertiary care hospitals of Isfahan, Iran. Infez Med. 2017;25(3):234-40.[PubMed Central:PMID:28956540] 12. Oliveira D, Borges A, Simões M. Staphylococcus aureus toxins and their molecular activity in infectious diseases. TOXINS. 2018;10(6):252. doi: 10.3390/toxins10060252.13. Janik E, Ceremuga M, Saluk-Bijak J, Bijak M. Biological toxins as the potential tools for bioterrorism.Int. J. Mol. Sci. 2019;20(5):1181. doi: 10.3390/ijms20051181.14. Tuffs S, Haeryfar S, McCormick J. Manipulation of innate and adaptive immunity by staphylococcal superantigens. Pathogens. 2018;7(2):53. doi: 10.3390/pathogens702005315. Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testingTwenty-FourthEdition, M100Ed24E; 2014.16. Hoveida L, Ataei B, Amirmozafari N, Noormohammadi Z. Species Variety, Antibiotic Susceptibility Patterns and Prevalence of Enterotoxin Genes in Staphylococci Isolated from Foodstuff in Central Iran. Iranian Journal of Public Health. 2020 Jan;49(1):96.17. Adwan G, Adwan K, Jarrar N, Salama Y, Barakat A. Prevalence of seg, seh and sei Genes among Clinical and Nasal Staphylococcus aureus Isolates in Palestine. Br Microbiol Res J. 2013;3(2):139-49.doi: 10.9734/BMRJ/2013/291318. Du X, Zhu Y, Song Y, Li T, Luo T, Sun G, et al. Molecular analysis of Staphylococcus epidermidis strains isolated from community and hospital environments in China. PLoS One. 2013;8(5):e62742. doi: 10.1371/journal.pone.0062742.19.Razavi S, Dadashi M, Pormohammad A, Khoramrooz S S, Mirzaii M, et al. Methicillin-Resistant Staphylococcus epidermidisin Iran: A Systematic Review and Meta-Analysis, Arch Clin Infect Dis. 2018 ; 13(4):e58410. doi: 10.5812/archcid.58410.20. Ramazanzadeh R, Salimizand H, Shahbazi B, Narenji H. Prevalence of mecA Gene of Methicillin Resistant Staphylococcus spp. Isolated from Nosocomial Infections and Environmental Specimens in Sanandaj Hospitals, Kurdistan, Iran. Res Mol Med. 2015;3(3):38-42. doi: 10.7508/rmm.2015.03.008.21. Xu Z, Shah HN, Misra R, Chen J, Zhang W, Liu Y, et al. The prevalence, antibiotic resistance and mecA characterization of coagulase negative staphylococci recovered from non-healthcare settings in London, UK.Antimicrob Resist Infect Control. 2018;7(1):73. doi: 10.1186/s13756-018-0367-4.22. Rahimi F, Bouzari M, Katouli M, Pourshafie M R. Antibiotic Resistance Pattern of Methicillin Resistant and Methicillin Sensitive Staphylococcus aureus Isolates in Tehran, Iran, Jundishapur J Microbiol. 2013 ; 6(2):144-149. doi: 10.5812/jjm.4896. 23. Shoja S, Nahaei MR, Nahaei M, Farajnia S, AHANGARZADEH RM, Nikvash S. Study of methicillin-resistance by oxacillin disc diffusion and pcr methods in Staphylococcus epidermidis isalates collected from blood cultures and their antibiotic susceptibility.Med J Tabriz Univ Med Sci. 2009; 31(1):39-44.24. Nourbakhsh, F. H. Momtaz. An investigation of antibiotic resistance pattern in the strains of methicillin-resistant Staphylococcus epidermidis isolated from clinical samples in Iisfahan province, Iran.Qom Univ Med Sci J. 2016;10(6):68-74. 25. Diep BA, Stone GG, Basuino L, Graber CJ, Miller A, des Etages SA, et al. The arginine catabolic mobile element and staphylococcal chromosomal cassette mec linkage: convergence of virulence and resistance in the USA300 clone of methicillin-resistant Staphylococcus aureus. J Infect Dis. 2008;197(11):1523-30. doi: 10.1086/587907.26. Granslo HN, Klingenberg C, Fredheim EG, Rønnestad A, Mollnes TE, Flægstad T. Arginine catabolic mobile element is associated with low antibiotic resistance and low pathogenicity in Staphylococcus epidermidis from neonates.Pediatr Res. 2010;68(3):237. doi: 10.1203/00006450-201011001-00463.27. Miragaia M, de Lencastre H, Perdreau-Remington F, Chambers HF, Higashi J, Sullam PM, et al. Genetic diversity of arginine catabolic mobile element in Staphylococcus epidermidis. PLoS One. 2009;4(11):e7722. doi: 10.1371/journal.pone.000772228. Pereira VC, Pinheiro L, Oliveira A, Martins KB, Riboli DFM, de Souza MdLR. Expression of superantigens and the agr system in Staphylococcus epidermidis. Microb Pathog. 2018;115:19-24. doi: 10.1016/j.micpath.2017.11.008.29. Rosenthal ME, Dever LL, Moucha CS, Chavda KD, Otto M, Kreiswirth BN. Molecular characterization of an early invasive Staphylococcus epidermidis prosthetic joint infection.MICROB DRUG RESIST. 2011;17(3):345-50. doi: 10.1089/mdr.2010.0157. 30. Vasconcelos N, Pereira V, Júnior JA, da Cunha MdL. Molecular detection of enterotoxins E, G, H and I in Staphylococcus aureus and coagulase‐negative staphylococci isolated from clinical samples of newborns in Brazil. J APPL MICROBIOL. 2011;111(3):749-62. doi: 10.1111/j.1365-2672.2011.05076.x31. Pinheiro L, Brito C, de Oliveira A, Martins P, Pereira V, da Cunha M. Staphylococcus epidermidis and Staphylococcus haemolyticus: molecular detection of cytotoxin and enterotoxin genes. TOXINS. 2015;7(9):3688-99. doi: 10.3390/toxins709368832. Alfatemi SM, Motamedifar M, Hadi N, Saraie HS. Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strains. Jundishapur journal of microbiology. 2014;7(6).33. Mehrabi F, Asgari A. Resistant Strains of Enterotoxigenic Staphylococcus aureus; Unknown Risk for Multiple Sclerosis Exacerbation. Iranian Red Crescent Medical Journal. 2015;17(9).
رهیافت های نوین در علوم سلولی و مولکولی JNACMS دوره 3 شماره 1 بهار 1404 Journal homepage: https://sanad.iau.ir/journal/nacms |
|
جداسازی سویههای استافیلوکوکوس اپیدرمیدیس مقاوم به متی سیلین حاوی ژن arcA تولید آنتروتوکسینهایA ، B ، C ، D ، E ، G وI از عفونتهای بیمارستانی در اصفهان
پریسا بهشود
گروه زیست شناسی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران.
اطلاعات مقاله |
| چکیده | ||
تاریخچه مقاله: دریافت:06/03/1404 پذیرش:20/04/1404 چاپ: بهار 1404 DOI: doi.org/10.82415/NACMS.2025.1207939 |
| استافیلوکوکوس اپیدرمیدیس انواع مختلفی از سموم پروتئین خارج سلولی از جمله انتروتوکسینهای استافیلوکوکی را تولید میکند که به عنوان سوپر آنتی ژن عمل میکنند و میتوانند شرایطی را برای حمله به سلولهای میزبان فراهم کنند. هدف از مطالعه حاضر تعیین الگوی مقاومت آنتی بیوتیکی و تشخیص ژنهای انتروتوکسین در سویههای استافیلوکوکوس اپیدرمیدیس مقاوم به متی سیلین حاوی ژن ACME-arcA در اصفهان بود. این بررسی بر روی 150 ایزوله استافیلوکوکوس جدا شده از عفونتهای مختلف بیمارستانی انجام شد. سویه های مقاوم به متی سیلین با روش PCR تایید شدند و الگوی ضد میکروبی ایزولهها با روش انتشار دیسک تعیین شد. سرانجام، ژنهای انتروتوکسین در سویههای مقاوم به متی سیلین حاوی ژن ACME-arcA با استفاده از PCR تشخیص داده شدند. از 150 ایزوله استافیلوکوکوس مورد بررسی، 100 ایزوله بهعنوان استافیلوکوکوس اپیدرمیدیس شناسایی شدند. از 100 ایزوله استافیلوکوکوس اپیدرمیدیس 65 ایزوله (65 درصد) ایزوله مقاوم به متی سیلین بودند. از این تعداد ، 33 ایزوله (7 /50 درصد) هر دو ژن mecA و ACME-arcA را داشتند. الگوها ضد میکروبی ایزولههای مقاوم به متی سیلین در این مطالعه نشان داد، بیشترین میزان مقاومت را به اریترومایسین (5/81 درصد) و کلیندامایسین (6/64 درصد) نشان میدهند. در حالیکه کمترین مقاومت را به ریفامپین (6/7 درصد) و لینزولاید (5/1 درصد) نشان دادند. علاوه بر این، فراوانی ژنهای انتروتوکسین sea, seb, sec,see, sed, seg, seh, sei بهترتیب 6/60 درصد، 6/63 درصد، 6/66 درصد، 1/15 درصد، 6 درصد، 7/72 درصد، 0 درصد و 7/75 درصد گزارش شد. تنوع انواع ژنهای انتروتوکسین و مقاومت آنتی بیوتیکی در سویههای استافیلوکوکوس اپیدرمیدیس مقاوم به متی سیلین از جمله دلایل نگرانی در مورد بهداشت عمومی است. بنابراین گزارش سریع و دقیق از وجود ژنهای انتروتوکسین از عفونتهای بیمارستان ضروری است.
| ||
کلمات کلیدی: الگوی مقاومت آنتی بیوتیکی، انتروتوکسین، مقاومت به متی سیلین.
|
| |||
* نویسنده مسئول: Email |
INTRODUCTION
In the recent two decades, the importance of coagulase-negative staphylococci has raised. Staphylococcus epidermidis is the most important member of the coagulase-negative staphylococci (CoNS), and have been connected to significant hospital-associated infections (HAI) which today is resistant to methicillin (1). More than 70% of the hospital isolates are methicillin-resistant Staphylococcus epidermidis (MRSE), which makes it difficult, and costly to treat. MRSE is one of the most important bacteria that cause such complications as bacteremia, endocarditis, wound infection, urinary tract infections, pneumonia, and skin, and soft tissue infections, particularly in the intensive care unit (ICU). These bacteria are considered as the third cause of hospital infection (2, 3).
The emergence of antibiotic-resistant MRSE strains in hospital environments might cause serious problems to hospitalized patients, especially in immunocompromised patients. This phenomenon ultimately leads to high mortality rates among patients in hospital environments (4-6). Staphylococcus epidermidis containing the ACME-arcA reserves are closely correlated with pathogens, and antimicrobial-resistant genes (7). ACME is a genetic region of the DNA integrated inside the orfX. This element adheres to the SCCmec element in MRSEs, and enhances the pathogenicity, and colonization of MRSEs in humans. However, the agent entry of this element into SCCmec has not yet been known (4, 8). ACME is in the downstream region of the staphylococcal cassette chromosome mec (SCCmec), and together make up the ACME-SCCmec. It seems the physical interactions between SCCmec, and ACME appear to increase antibiotic resistance, and pathogenicity in staphylococci (7, 8). Today, the infectious transmitted diseases in hospitals pose a major global problem, some of which are transmitted through contaminated foods in hospital (4, 8). Food poisoning occurs as a result of eating foods that contain heat-resistant enterotoxins, and are usually produced by staphylococci. These toxins are injected into the circulatory system, then affecting the incontinent vomiting center to produce such symptoms as nausea, vomiting, rarely diarrhea, and abdominal muscle pains (7-9).
Enterotoxins are transmitted horizontally through mobile genetic elements (MGEs) such as transposons, bacteriophages, conjugative plasmids, and pathogenicity islands (PAIs). They inflict serious dangers, particularly to the elderly, immunocompromised individuals, pregnant women, and infants. Staphylococcal enterotoxins in the group of superantigens (SAgs) have 23 different types. Depending on the type of enterotoxin, the amount of produced toxins ranges from 10 ng to 20 μg (7, 9, 11). Enterotoxins are similar in structure, and biological activity but differences in antigenic properties. More than 95% of the food poisoning enterotoxins produced by the Staphylococcus epidermidis are part of the A-E groups. In addition, enterotoxin to being the basic reason for food poisoning, the main impression in pathological activities, such as osteomyelitis, sepsis, and respiratory distress syndrome (11,13, 28).
Staphylococcus enterotoxins can tolerate 100°C for half an hour. Their thermal resistance in food is higher than that in the laboratory cultures, so their biological activity remains unchanged after the heating stages of food preparation. Moreover, these toxins gastric resistance to acid, and activity remained even after food digestion.
Although pasteurization might destroy staphylococcal cells, the heat-resistant staphylococci enterotoxins remains biologically strenuous. Therefore, these toxins should be considered as important factors of food poisoning (10-13). All enterotoxins are mitogens of T cells that cause non-specific proliferation of T cells, and can provide conditions to attack host cells ; even 0.1mg of enterotoxins can stimulate T cells, and cause digestive disorders without damaging the intestinal tissue (10-14). The present study was designed, and implemented for the isolation ,and detection of sea, seb, sec, sed, see, seg, seh, and sei genes in mecA, and ACME-arcA positive strains isolated from hospital infections.
Materials and Methods
Strain isolation and identification
This cross-sectional study was done, during a period of 6 months in 2020. On a total of 150 staphylococcal isolates acquired from different nosocomial infections such as urine, blood, wound, catheter, throat in hospitals of Isfahan (Shariati, Gharazi, and Mehregan hospitals). Samples were incubated at 37 °C for 24 hours in blood agar (Merck, Germany). After colony growth, complementary tests based on using conventional bacteriological methods such as gram staining, culture on mannitol salt agar (MSA) (Merck, Germany), other biochemical tests such as coagulase, and novobiocin sensitivity assay were performed (15).
Detection of mecA genes by Polymerase Chain Reaction
The PCR method was used to detect MRSE isolates according to a described protocol in Hoveida et al (16). All DNA of strains was extracted, utilizing a DNA extraction kit (CinnaGen, Iran). The amplification reaction was performed in a final volume of 25 μl, containing 5 μl of genomic DNA, and 12.5 µL of Taq DNA polymerase, PCR master mix contained 2.5 μl 10x buffer, 0.6 μl MgCl2, 0.4 μl dNTP, 0.5 μl of each primer (10 pmol/ μl), and 15.2 μl ddH2O. A total of 35 cycles were performed with an initial denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 15s, annealing at 55°C for 15s, and extension at 72°C for 20s, followed by a final extension at 72°C for 5 min. The PCR products were analyzed by electrophoresis on a 1.5% agarose gel, stained with SYBR Green. The primer sequence used in this reaction is shown in Table1.
Antimicrobial susceptibility testing
Antimicrobial susceptibility patterns of MRSE strains were done according to disk diffusion procedure (Kirby–Bauer). For this purpose, antibiotics including erythromycin (15 μg), clindamycin (2 μg), cefoxitin (30 μg), tetracycline (30 μg), gentamicin (10 μg), ciprofloxacin (5 μg), cotrimoxazole (25 μg), rifampicin (5 μg), linezolid (30 μg) (Mast, UK) have been used (14), After 24h of incubation, the diameter of zone of inhibition of bacterial growth was measured, and results compared to the reference tables prepared by CLSI (15).
Screening of ACME-arcA gene
Identification of the ACME-arcA gene in the MRSE isolates was done using a thermal cycle, and specific primers for this gene. The primer sequence, and PCR condition are shown in Table1 (7). Briefly, all DNA of strains was extracted, utilizing a DNA extraction kit (CinnaGen, Iran). The amplification reaction was performed in a final volume was adjusted to 25 μl, containing 1 μl of genomic DNA, and 12.5 µL of Taq DNA polymerase, PCR master mix (CinnaGen, Iran), 1 μl of each primer, and 15.2 μl ddH2O. A total of 35 cycles were performed with an initial denaturation at 96°C for 5 min, 35 cycles of denaturation at 94°C for 45min, annealing at 45.5°C for 60 min, and extension at 72°C for 1min, followed by a final extension at 72°C for 10 min. The amplification products were analyzed by electrophoresis on a 1% agarose gel, stained with SYBR Green (7).
Detection of enterotoxin genes
To detection of enterotoxin genes, DNA of each isolate was extracted, utilizing a DNA extraction kit (CinnaGen, Iran) according to the manufacturer's instructions.
The DNA concentration, and purity was confirmed using Nanodrop a 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). PCR specific primers, and conditions utilized to sequence genomic DNA was shown in Table 1.
Statistical Analysis
All analyses were carry outed using SPSS Statistics version 20 (SPSS, Chicago, USA), using chi-square test, and kappa coefficient and values < 0.05 were considered statistically significant.
RESULTS
Out of 150 nosocomial infections, 100 Staphylococcus epidermidis strains were isolated. Among the 100 of Staphylococcus epidermidis recovered from nosocomial infections, 65 isolates (65%) were found resistant to methicillin (MRSE) (Figure1(A)), and of these, 33 isolates (50.76%) had both mecA, and ACME-arcA genes (Figure1(B)). The antimicrobial susceptibility patterns of MRSE isolates in this study showed that the MRSE isolates exhibited the highest rates of resistance to erythromycin (81.5%), clindamycin (64.6%), cefoxitin (63.07%), and tetracycline (61.5%), while they showed the lowest resistance to rifampicin (7.6%), and linezolid (1.5%) (Table 2). The antimicrobial resistance patterns of various types of hospital infections against commonly utilized antibacterial agents is shown in Table 3. Also, the frequencies of sea, seb, sec, sed, see, seg, seh, and sei genes were 60.6% (20 strains), 63.6% (21 strains), 66.6% (22 strains), 15.1 % (5 strains), 6% (2 strains), 72.7% (24 strains), 0% (0 strains), and 75.7% (25 strains) respectively, in the isolates containing the mecA, and ACME-arcA genes. Figure 1 shows the patterns according to the primers utilization in the PCR test. The sei gene isolated from urine infection that showed the highest ratio between enterotoxin genes (Figure 2).
Table 1: Primer sequence used in the PCR reaction
Gene | Amplicon size | Sequence | Annealing temperature | Reference |
mec | 310 bp | F:TGGCTATCGTGTCACAATCG
R:CTGGAACTTGTTGAGCAGAG |
55°C | (16) |
arcA
| 486 bp | F: GAG CCA GAA GTA CGC R: CAC GTA ACT TGC TAG AAC GA |
45.5°C | (7) |
sea
| 120bp | F: CCTTTGGAAACGGTTAAAACG R: TCTGAACCTTCCCATCAAAAAC |
55°C | (16) |
seb
| 164bp | F: GTATGGTGGTGTAACTGAGC R:CCAAATAGTGACGAGTTAGG |
50°C | (32) |
sec
| 257 bp | F: GCAGGTACTCTATAAGTGCC R:GACATAAAAGCTAGGAATTT |
50°C | (33) |
sed | 278bp | F: CCAATAATAGGAGAAAATAAAAG
R: ATTGGTATTTTTTTTCGTTC |
50°C
| (32) |
see
| 170bp
| F:CAAAGAAATGCTTTAAGCAATCTTAGGCCAC R: CTTACCGCCAAAGCTG
|
55°C | (31) |
seg | 287 bp | F: TGCTCAACCCCGATCCTAAATTAGACGA R: CCTCTTCCTTCAACAGGTGGAGACG |
55°C
| (17) |
seh | 376 bp
|
F:CAATCACATCATATGCGAAAGCAG R:CATCTACCCAAACATTAGCACC
|
50°C | (31) |
sei | 454 bp | F: TGGAGGGGCCACTTTATCAGGA R: TCCATATTCTTTGCCTTTACCAGTG |
50°C | (17) |
Figure (1).Electrophoresis gel images of mecA (A), arcA (B), sea (C), seb (D), sec (E), sed (F), see (G), seg (H), and sei (I) genes. In each image, C+: positive control, C-: negative control, and M: marker ladder
Table 2: Antibiotic susceptibility patterns of MRSE isolates
Antibiotic | No. of strains | Resistance (%) | No. of strains | semi resistance (%) | No. of strains | Sensitivity (%) |
erythromycin | 53 | 81.5 | 7 | 10.7 | 5 | 7.6 |
clindamycin | 42 | 64.6 | 21 | 32.3 | 3 | 4.6 |
cefoxitin | 41 | 63.07 | 20 | 30.7 | 4 | 6.1 |
tetracyclin | 40 | 61.5 | 19 | 29.2 | 6 | 9.2 |
gentamicin | 39 | 60 | 21 | 32.3 | 5 | 7.6 |
cotrimoxazole | 38 | 58.4 | 20 | 30.7 | 7 | 10.7 |
ciprofloxacin
| 30 | 46.1 | 23 | 35.3 | 12 | 18.4 |
rifampicin | 5 | 7.6 | - | - | 60 | 92.3 |
linezolid | 1 | 1.5 | 4 | 6.1 | 60 | 92.3 |
Table 3. Antimicrobial resistance patterns of various types of hospital infections against commonly utilized antibiotics
Antimicrobial Agents
| Types of Infections
| |||||
Urine (28) | Blood (18) | Wound (12) | Catheter (5) | Throat (2) | Total (65) | |
erythromycin | 24 (85.7%) | 17 (94.4%) | 8 (66.6%) | 3 (60%) | 1 (50%) | 53 (81.5%) |
clindamycin | 20 (71.4%) | 11 (61.1%) | 8 (66.6%) | 3 (60%) | - | 42 (64.6%) |
cefoxitin
| 13 (46.4%) | 14 (77.7%) | 11 (91.6%) | 2 (40%) | 1 (50%) | 41 (63.07%) |
tetracyclin | 21 (75%) | 8 (44.4%) | 9 (75%) | 2 (40%) | - | 40 (61.5%) |
gentamicin | 17 (60.7%) | 9 (50%) | 10 (83.3%) | 3 (60%) | - | 39 (60%) |
cotrimoxazole | 11 (39.2%) | 13 (72.2%) | 9 (75%) | 4 (80%) | 1 (50%) | 38 (58.4%) |
ciprofloxacin | 14 (50%) | 8 (44.4%) | 5 (41.6%) | 3 (60%) | - | 30 (46.1%) |
rifampicin
| 1 (3.5%) | 3 (16.6%) | 1 (8.3%) | - | - | 5 (7.6%) |
linezolid | - | 1 (5.5%) | - | - | - | 1 (1.5%) |
Figure(2). Distribution of enterotoxin genes between methicillin-resistant Staphylococcus epidermidis strains gathered from different hospital infections
DISCUSSION
It has been more than two decades since coagulase-negative staphylococci have emerged as opportunistic pathogens. The use of embedded medical devices (e.g. various types of prostheses, and catheters) over the past decades has made methicillin-resistant Staphylococcus epidermidis an important pathogen in the hospital. The global studies showed that 60‒85% of clinical Staphylococcus epidermidis isolates are resistant to methicillin (18,19, 20).
In our study, we found that 65 Staphylococcus epidermidis strains out of 100 strains (65%) were MRSE. According to the outcomes of the studies systematic review, and meta-analysis by Razavi et al in 2018, MRSE had a higher diffusion level in Isfahan, Tabriz, Sanandaj, and Arak than Tehran, because of in Tehran better MRSE infection controlled (19). Also, the obtained results by Razavi et al. indicating that the level of MRSE infections was higher in the western departments of Iran than the other departments (19, 20). In the study of Xu et al. in the community of Shanghai area of China in 2018, the prevalence of Staphylococcus epidermidis, and MRSE in healthcare personnel were reported to be 61.3%, and 30% respectively (21). According to Shamansouri et al. (2016) in Isfahan, the frequency of mecA in clinical isolates were reported to be 56.41% (7). Clearly, the abundance of MRSE isolates in these three studies was consistent with our findings. In this study, the methicillin-resistant Staphylococcus epidermidis isolates exhibited the highest resistance to erythromycin (81.5%), clindamycin (64.6%), cefoxitin (63.07%), and tetracycline (61.5%), while they showed the lowest resistance to rifampicin (7.6%), and linezolid (1.5%). Here, the highest resistance to erythromycin is consistent with those reported for the hospitals in Tehran, Tabriz, and Isfahan (2, 22, 23).
According to the results of the current, and similar previous studies across Iran, we can conclude that the antibiotics linezolid and, daptomycin can be effectively used in the therapy of infections due to MRSE (5). In our study, we found that from 65 Staphylococcus epidermidis isolates, 33 isolates (50.76%) had ACME-arcA genes. In the study of Diep et al. the spread of ACME-arcA was presented 60% (25). In a survey conducted by Shamansouri et al. (2016) in Isfahan, ACME-arcA was reported in 14 (20.58%) of MRSE isolates, and they reported that the ACME-arcA gene was able to promote the increase, maintenance, and diffusion of strains with multiple-drug resistance (7).
In the study of Xu et al. in the community of Shanghai area of China in 2018, the prevalence of ACME-arcA was reported in 67.7% of MRSE isolates, and 74.1 of Staphylococcus epidermidis strains, and 83.3% of Methicillin-sensitive Staphylococcus epidermidis (MSSE) isolates (21). The result of this study was almost close to ours. Granslo et al. (2010) observed that 40% of the Staphylococcus epidermidis isolates extracted from contaminated blood cultures contained the ACME gene (26). Miragaia et al. (2009) found that 51% of the Staphylococcus epidermidis in the world areas were the ACME positive (27, 7). the results of this study are in agreement with our research.
Food poisoning is a foodborne illness. Staphylococcus epidermidis in nosocomial infection produce toxins called enterotoxins that are a cause of food poisoning agents. Previous studies have shown patients carriers enterotoxin can be a source of infection in the community, especially in hospitals. PCR analysis conducted, in the present study, revealed that the frequencies of sea, seb, sec, sed, see, seg, seh, and sei genes were 60.6% (20 strains), 63.6% (21 strains), 66.6% (22 strains), 15.1 % (5 strains), 6 % (2 strains), 72.7% (24 strains), 0% (0 strains), and 75.7% (25 strains) respectively, in the isolates.
According to Pereira et al. (2017) Staphylococcus epidermidis had a high prevalence of superantigenic genes in coagulase-negative staphylococci that cause severe infections. In this study, the frequency of sea, seb, sec, sed, see, seg, she, and sei genes were 69.8%, 64.3%, 69.5%, 71.4%, 50%, 69.7%, 61.5%, and 72% respectively (28). The result of this study was almost close .
The sea gene is carried by a prophage that facilitates its diffusion among staphylococcal strains, and its product is enterotoxin A, as one of the major food poisoning toxins (28). Many studies have shown that these genes are predominant in CoNS (29).
Vasconcelos et al. (2011) showed that the most common enterotoxin genes were seg, and sei staphylococci, with a frequency of 62.7%, and 66.7%, respectively (30). These genes exist in the egc cluster, which also includes genes encoding other staphylococcal enterotoxins, and these genes have shown to be highly correlated with each other. The result of this study was similar to ours.Differences between the results of different studies may be attributed to differences in the method used, and in the samples studied, including the number, environment, and geographical source of the samples (29). Pinheiro et al. (2015) detected enterotoxin genes in 95.3% of the blood cultures infected with Staphylococcus epidermidis isolates, and that had at least one enterotoxin gene, the most common of which was the classical enterotoxin genes such as sea, seb, sec, sed, see, seg, seh, and sei with frequencies equal to 59%, 29%, 30%, 3%, 3%, 73%, 13%, and 74% (31). The results of the sea, seg, see, and sei genes in this study were similar to ours.
Conclusion
Tracing of antibiotic resistance, and enterotoxin genes among ACME-arcA encoding MRSE strains indicated that clinical samples might represent a potential health hazard. The general objective of controlling hospital infections is to reduce these infections as much as possible. Not only these infections cause secondary complications but they also increase the possibility of food poisoning, which in turn leads to high mortality rates, prolonged hospitalization, and high-cost treatment. Therefore, studies about tracing of such isolates in the nosocomial infections are very recommended.
Acknowledgements
We thanksgiving Dr. Manouchehr Momeni Shahraki, for his continual kindness and mental contributions during this study.
Conflict of Interests: No conflict of interest was announced by the authors.
Ethical considerations
Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or fal-sification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
Financial Disclosure
The authors announce that they had no financial interests related to the material in the manuscript.
Funding/Support
Self-funding.
References
1. Gordon RJ, Miragaia M, Weinberg AD, Lee CJ, Rolo J, Giacalone JC, et al. Staphylococcus epidermidis colonization is highly clonal across US cardiac centers.Int J Infect Dis. 2012;205(9):1391-8.
doi: 10.1093/infdis/jis218.
2. Aghazadeh M, Ghotaslou R, Rezaee MA, Moshafi MH, Hojabri Z, Saffari F. Determination of antimicrobial resistance profile and inducible clindamycin resistance of coagulase negative staphylococci in pediatric patients: the first report from Iran. World J Pediatr. 2015;11(3):250-4.doi: 10.1007/s12519-014-0524-7.
3. Halaji M, Karimi A, Shoaei P, Nahaei M, Khorvash F, Ataei B, et al. Distribution of SCCmec elements and presence of Panton-Valentine Leukocidin in Methicillin-Resistant Staphylococcus epidermidis isolated from clinical samples in a University Hospital of Isfahan City, Iran. J Clin Diagn Res. 2017;11(7):DC27. doi: 10.7860/JCDR/2017/25518.10258.
4. Lindgren J, Thomas VC, Olson M, Chaudhari S, Nuxoll AS, Schaeffer C, et al. Arginine deiminase in Staphylococcus epidermidis functions to augment biofilm maturation through pH homeostasis. J Bacteriol. 2014;196(12):2277-89. doi: 10.1128/JB.00051-14.
5. Danesh M, Rahimi F, Arabestani MR. Antibiotic resistance pattern of Staphylococcus epidermidis strains isolated from a referral hospital in Isfahan. J Clin Infect Dis Trop Med. 2016; 20(71): 25-31.
6.Wang PJ, Xie CB, Sun FH, Guo LJ, Dai M, Cheng X, Ma YX. Molecular characteristics of methicillin-resistant Staphylococcus epidermidis on the abdominal skin of females before laparotomy. Int J Mol Sci. 2016;17(6):992. doi: 10.3390/ijms17060992.
7. Shamansouri S, Zadeh V, Khazaei M. Study on the percent of frequency of ACME-Arca in clinical isolates resistant to methicillin-Staphylococcus epidermidis in Isfahan, Iran. J Fundam Appl Sci. 2016;8(2):1046-57.http://dx.doi.org/10.4314/jfas.v8i2S.119
8.Deplano A, Vandendriessche S, Nonhoff C, Dodémont M, Roisin S, Denis O. National surveillance of Staphylococcus epidermidis recovered from bloodstream infections in Belgian hospitals. J. Antimicrob. Chemother.2016;71(7):1815-9. doi: 10.1093/jac/dkw086.
9. Ertas N, Gonulalan Z, Yildirim Y, Kum E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique.Int J Food Microbiol. 2010;142(1-2):74-7.
doi: 10.1016/j.ijfoodmicro.2010.06.002.
10. Fisher EL, Otto M, Cheung GY. Basis of virulence in enterotoxin-mediated staphylococcal food poisoning. Front Microbiol. 2018; 9: 436.doi: 10.3389/fmicb.2018.00436
11. Karimi M, Esfahani BN, Halaji M, Mobasherizadeh S, Shahin M, Havaei SR, et al. Molecular characteristics and antibiotic resistance pattern of Staphylococcus aureus nasal carriage in tertiary care hospitals of Isfahan, Iran. Infez Med. 2017;25(3):234-40.[PubMed Central:PMID:28956540]
12. Oliveira D, Borges A, Simões M. Staphylococcus aureus toxins and their molecular activity in infectious diseases. TOXINS. 2018;10(6):252. doi: 10.3390/toxins10060252.
13. Janik E, Ceremuga M, Saluk-Bijak J, Bijak M. Biological toxins as the potential tools for bioterrorism.Int. J. Mol. Sci. 2019;20(5):1181. doi: 10.3390/ijms20051181.
14. Tuffs S, Haeryfar S, McCormick J. Manipulation of innate and adaptive immunity by staphylococcal superantigens. Pathogens. 2018;7(2):53. doi: 10.3390/pathogens7020053
15. Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testingTwenty-FourthEdition, M100Ed24E; 2014.
16. Hoveida L, Ataei B, Amirmozafari N, Noormohammadi Z. Species Variety, Antibiotic Susceptibility Patterns and Prevalence of Enterotoxin Genes in Staphylococci Isolated from Foodstuff in Central Iran. Iranian Journal of Public Health. 2020 Jan;49(1):96.
17. Adwan G, Adwan K, Jarrar N, Salama Y, Barakat A. Prevalence of seg, seh and sei Genes among Clinical and Nasal Staphylococcus aureus Isolates in Palestine. Br Microbiol Res J. 2013;3(2):139-49.doi: 10.9734/BMRJ/2013/2913
18. Du X, Zhu Y, Song Y, Li T, Luo T, Sun G, et al. Molecular analysis of Staphylococcus epidermidis strains isolated from community and hospital environments in China. PLoS One. 2013;8(5):e62742. doi: 10.1371/journal.pone.0062742.
19.Razavi S, Dadashi M, Pormohammad A, Khoramrooz S S, Mirzaii M, et al. Methicillin-Resistant Staphylococcus epidermidisin Iran: A Systematic Review and Meta-Analysis, Arch Clin Infect Dis. 2018 ; 13(4):e58410. doi: 10.5812/archcid.58410.
20. Ramazanzadeh R, Salimizand H, Shahbazi B, Narenji H. Prevalence of mecA Gene of Methicillin Resistant Staphylococcus spp. Isolated from Nosocomial Infections and Environmental Specimens in Sanandaj Hospitals, Kurdistan, Iran. Res Mol Med. 2015;3(3):38-42. doi: 10.7508/rmm.2015.03.008.
21. Xu Z, Shah HN, Misra R, Chen J, Zhang W, Liu Y, et al. The prevalence, antibiotic resistance and mecA characterization of coagulase negative staphylococci recovered from non-healthcare settings in London, UK.Antimicrob Resist Infect Control. 2018;7(1):73. doi: 10.1186/s13756-018-0367-4.
22. Rahimi F, Bouzari M, Katouli M, Pourshafie M R. Antibiotic Resistance Pattern of Methicillin Resistant and Methicillin Sensitive Staphylococcus aureus Isolates in Tehran, Iran, Jundishapur J Microbiol. 2013 ; 6(2):144-149. doi: 10.5812/jjm.4896.
23. Shoja S, Nahaei MR, Nahaei M, Farajnia S, AHANGARZADEH RM, Nikvash S. Study of methicillin-resistance by oxacillin disc diffusion and pcr methods in Staphylococcus epidermidis isalates collected from blood cultures and their antibiotic susceptibility.Med J Tabriz Univ Med Sci. 2009; 31(1):39-44.
24. Nourbakhsh, F. H. Momtaz. An investigation of antibiotic resistance pattern in the strains of
methicillin-resistant Staphylococcus epidermidis isolated from clinical samples in Iisfahan province, Iran.
Qom Univ Med Sci J. 2016;10(6):68-74.
25. Diep BA, Stone GG, Basuino L, Graber CJ, Miller A, des Etages SA, et al. The arginine catabolic mobile element and staphylococcal chromosomal cassette mec linkage: convergence of virulence and resistance in the USA300 clone of methicillin-resistant Staphylococcus aureus. J Infect Dis. 2008;197(11):1523-30. doi: 10.1086/587907.
26. Granslo HN, Klingenberg C, Fredheim EG, Rønnestad A, Mollnes TE, Flægstad T. Arginine catabolic mobile element is associated with low antibiotic resistance and low pathogenicity in Staphylococcus epidermidis from neonates.Pediatr Res. 2010;68(3):237. doi: 10.1203/00006450-201011001-00463.
27. Miragaia M, de Lencastre H, Perdreau-Remington F, Chambers HF, Higashi J, Sullam PM, et al. Genetic diversity of arginine catabolic mobile element in Staphylococcus epidermidis. PLoS One. 2009;4(11):e7722. doi: 10.1371/journal.pone.0007722
28. Pereira VC, Pinheiro L, Oliveira A, Martins KB, Riboli DFM, de Souza MdLR. Expression of superantigens and the agr system in Staphylococcus epidermidis. Microb Pathog. 2018;115:19-24. doi: 10.1016/j.micpath.2017.11.008.
29. Rosenthal ME, Dever LL, Moucha CS, Chavda KD, Otto M, Kreiswirth BN. Molecular characterization of an early invasive Staphylococcus epidermidis prosthetic joint infection.MICROB DRUG RESIST. 2011;17(3):345-50. doi: 10.1089/mdr.2010.0157.
30. Vasconcelos N, Pereira V, Júnior JA, da Cunha MdL. Molecular detection of enterotoxins E, G, H and I in Staphylococcus aureus and coagulase‐negative staphylococci isolated from clinical samples of newborns in Brazil. J APPL MICROBIOL. 2011;111(3):749-62. doi: 10.1111/j.1365-2672.2011.05076.x
31. Pinheiro L, Brito C, de Oliveira A, Martins P, Pereira V, da Cunha M. Staphylococcus epidermidis and Staphylococcus haemolyticus: molecular detection of cytotoxin and enterotoxin genes. TOXINS. 2015;7(9):3688-99. doi: 10.3390/toxins7093688
32. Alfatemi SM, Motamedifar M, Hadi N, Saraie HS. Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strains. Jundishapur journal of microbiology. 2014;7(6).
33. Mehrabi F, Asgari A. Resistant Strains of Enterotoxigenic Staphylococcus aureus; Unknown Risk for Multiple Sclerosis Exacerbation. Iranian Red Crescent Medical Journal. 2015;17(9).
Isolation of Methicillin-Resistant Staphylococcus epidermidis Strains Containing the arcA Gene Producing Enterotoxins A, B, C, D, E, G, and I from Hospital Infections in Isfahan, Iran.
Department of Biology, ShK.C., Islamic Azad University, Shahrekord, Iran.
Corresponding Author: parisa_behshood@yahoo.com
ABSTRACT
Staphylococcus epidermidis produces various types of extracellular protein toxins including staphylococcal enterotoxins that act as superantigens, and can provide conditions to attack host cells. The goal of the current study was to determine antibiotic resistance patterns, and detection of prevalent enterotoxin genes in MRSE strains containing the ACME-arcA gene in Isfahan. This survey was done, on a total of 150 staphylococcal isolates acquired from different nosocomial infections. MRSE strains isolated by the PCR procedure. The antimicrobial patterns of MRSE isolates were determined by the disk diffusion procedure. Finally, enterotoxin genes in MRSE strains containing the ACME-arcA gene were detected by using the PCR system. Out of 150 clinical infections, 100 Staphylococcus epidermidis strains were isolated. Among 100 Staphylococcus epidermidis strains, 65 (65%) isolates were MRSE. Of these, 33 isolates (50.7%) had both mecA, and ACME-arcA genes. The antimicrobial patterns of MRSE isolates in this study showed that the MRSE isolates exhibited the highest rates of resistance to erythromycin (81.5%), and clindamycin (64.6%), while they showed the lowest resistance to rifampicin (7.6%), and linezolid (1.5%). Moreover, the frequency of enterotoxin genes sea, seb, sec, sed, see, seg, seh, and sei was reported 60.6%, 63.6%, 66.6%, 15.1%, 6%, 72.7%, 0%, and 75.7% respectively, in the isolates containing the mecA, and ACME-arcA genes. The variety of enterotoxin genes types and resistance index among ACME-arcA encoding MRSE are causes for a public health concern; so rapid and accurate reporting of the presence of enterotoxin genes from hospital infections is essential.
Keywords: Antibiotic Resistance pattern, Enterotoxins, Methicillin-Resistant.