Investigation of the inhibitory effect of engineered probiotic Lactobacillus acidophilus on the growth of Salmonella enteritidis
Subject Areas : Food Microbial Contamination
Mottahareh Eskandari
1
(
IAU,,.shahrekord Branch
)
Abbas Doosti
2
(
Biotechnology Research Center, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
)
Keywords: Salmonella, Lactobacillus acidophilus, Tachyplesin,
Abstract :
Probiotics are living cellular components that have beneficial effects on the host in a certain number when they enter the gastrointestinal tract. The aim of this study was to produce and evaluate the effects of the probiotic bacterium Lactobacillus acidophilus, which expresses the peach's peptide Tachyplesin I, on the growth of Salmonella. The recombinant plasmid pNZ8148- Tachyplesin containing the Tachyplesin gene was introduced into E. coli by heat shock and then purified. The recombinant vector containing the tachiplicin gene was then inserted into Lactobacillus acidophilus by electroporation method and screened by chloramphenicol antibiotic and PCR. Then, the inhibitory effect of engineered Lactobacillus acidophilus on the growth of Salmonella was investigated and compared with antibiotic discs..After confirmation of the entry of plasmid pNZ8148-Tachyplesin into Lactobacillus acidophilus, it had an inhibitory effect on the growth of Salmonella pathogenic bacterium as the diameter of the growth inhibition zone created on Salmonella was acceptable under the influence of engineered Lactobacillus. After comparing the diameter of the auras of ampicillin, chloramphenicol and tetracycline antibiotic disks with engineered lactobacillus and performing statistical analysis, no significant difference was reported. Considering that the presence of Tachyplesin gene in Lactobacillus acidophilus was confirmed, the resulting growth inhibition zone around Salmonella indicates that the expression and secretion of Tachyplesin gene in Lactobacillus has an antibiotic-like effect on Salmonella.
_||_
آبررسی تاثیر مهاری پروبیوتیک مهندسی شده لاکتوباسیلوس اسیدوفیلوس بر رشد سالمونلا انتریتیدیس
چکیده
ﭘﺮوﺑﻴوتیکها اﺟﺰاي ﺳﻠﻮﻟﻲ ﻣﻴﻜﺮوﺑﻲ زﻧﺪهاي ﻫﺴﺘﻨﺪ ﻛﻪ وﻗﺘﻲ وارد دﺳﺘﮕﺎه ﮔﻮارش میشوند یک یا چند اثر مفید را روی سلامتی میزبان میگذارند. هدف از این تحقیق تولید و بررسی اثرات باکتری پروبیوتیک لاکتوباسیلوس اسیدوفیلوس (ATCC 4356) بیان کننده پپتید Tachyplesin I خرچنگ نعل اسبی بر رشد باکتری سالمونلا انتریتیدیس (ATCC 13311) است.
پلاسمید نوترکیب pNZ8148- Tachyplesin I به روش شوک حرارتی وارد باکتری E.coli شد و سپس تخلیص شد. در مرحله بعد وکتور نوترکیب حاوی ژن Tachyplesin I به روش الکتروپوریشن وارد باکتری لاکتوباسیلوس اسیدوفیلوس شد و غربالگری توسط آنتیبیوتیک کلرامفنیکل و PCR انجام گرفت. سپس تاثیر مهاری باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده بر روی رشد سالمونلا بررسی و با دیسکهای آنتی بیوتیکی مقایسه گردید.
ورود پلاسمید pNZ8148-Tachyplesin I درون باکتری لاکتوباسیلوس اسیدوفیلوس به کمک آنتی بیوتیک و واکنش PCR تایید شد. سپس لاکتوباسیلوس مهندسی شده تاثیر مهاری بر روی رشد باکتری سالمونلا را نشان داد، به صورتیکه قطر هاله عدم رشد ایجاد شده بر روی سالمونلا تحت تاثیر لاکتوباسیلوس مهندسی شده قابل قبول بود. پس از مقایسه قطر هالههای دیسکهای آنتیبیوتیکی آمپیسیلین، کلرامفنیکل و تتراسایکلین با لاکتوباسیلوس مهندسی شده و انجام آنالیز آماری، بین لاکتوباسیلوس دستکاری نشده (کنترل) و لاکتوباسیلوس بیان کننده ژن Tachyplesin تفاوت معنی دار در هاله عدم رشد دیده شد.
با توجه به این که حضور ژنI Tachyplesin درون لاکتوباسیلوس اسیلویدوفیلوس تایید شد، هاله عدم رشد حاصل از آن در اطراف سالمونلا نشان دهنده این مطلب است که بیان و ترشح ژن Tachyplesin I درون لاکتوباسیلوس اثری مشابه آنتیبیوتیک بر سالمونلا دارد.
واژه های کلیدی: لاکتوباسیلوس اسیدوفیلوس، سالمونلا، Tachyplesin I
مقدمه
ﭘﺮوﺑﻴوتیکها اﺟﺰاي ﻣﻴﻜﺮوﺑﻲ زﻧﺪهاي ﻫﺴﺘﻨﺪ ﻛﻪ وﻗﺘﻲ وارد دﺳﺘﮕﺎه ﮔﻮارش میشوند از راه ایجاد تعادل میکروبی در روده اثرات مفیدی بر میزبان خود اعمال میدارند از ﺟﻤﻠﻪ اﻳﻦ اﺛﺮات ﻣﻔﻴﺪ میتوان ﺑﻪ اﻓﺰاﻳﺶ ﻫﻀﻢ ﻣﻮاد ﻏﺬاﻳﻲ، ﺗﻘﻮﻳﺖ ﺳﻴﺴﺘﻢ اﻳﻤﻨﻲ ﺑﺪن و ﺑﺎﻻ ﺑﺮدن ﻣﻘﺎوﻣﺖ در ﺑﺮاﺑﺮ ﻋﻔﻮنتها و ﺧﻮاص ﺿﺪ ﺟﻬﺶ زاﺋﻲ و ﺿﺪ ﺳﺮﻃﺎﻧﻲ اﺷﺎره ﻛﺮد (Abdel et al.,2013). باکتریهای مولد اسید لاکتیک به ویژه لاكتوباسیلوسها و بیفیدوباکتریومها به طور عادی جزیی از سیستم دستگاه گوارش هستند و پروبیوتیک محسوب میشوند (Pimentel et al.,2020). رابرفرويد (2007) تعريف جديدی از پربیوتیک ارائه کرد که طبق آن پربیوتیکها ترکیبات تخمیر شوندهای هستند که به طور انتخابی سبب تغییرات ويژه در ترکیب و يا فعالیت میکروفلورای روده میشوند (Tufarelli et al.,2016). پروبیوتیکها بر تعادل باکتریهای مفید و مضر روده تأثیر میگذارند و این تعادل را به نفع افزایش جمعیت باکتریهای مفید تغییر میدهند، در حقیقت پروبیوتیکها از همین طریق اثرات سلامت بخش خود را در بدن میزبان القا میکنند. دوز پروبیوتیک مصرف شده عامل مهمی است که بر تراکم میکروارگانیسمهای موجود در بخشهای مختلف دستگاه گوارش تأثیر میگذارد. پروبیوتیکها همچنین قادر هستند اختلالات میکروبی روده در میزبان را پس از درمان آنتی بیوتیکی به حداقل برسانند(Burns and Rowland, 2010; Gaspar et al.,2018 ). ویژگیهای عملکردی پروبیوتیکها شامل موارد زیر است (Jay, 2012):
1- رقابت برای جذب مواد غذایی: پروبیوتیکها از مواد غذایی که مورد مصرف باکتریهای بیماریزا قرار میگیرند استفاده میکنند.
2- مهار رقابتی جایگاههای اتصال باکتری بر روی سطوح اپیتلیال روده: گفته میشود که بسیاری از پاتوژنهای روده ای برای استقرار در روده و ایجاد بیماری باید بتوانند به روده متصل شوند با توجه به این مسئله تعدادی از گونههای پروبیوتیک به دلیل توانایی اتصالشان به سلولهای اپی تلیال انتخاب شدهاند.
3- تعدیل میکروفلور روده: پروبیوتیک با کاهش تعداد کلی فرمها، کلستریدیا و افزایش لاکتوباسیلها یا بیفیدوباکترها ترکیب میکروفلور روده را بهبود میبخشد.
4- کاهش سموم: پروبیوتیکها تولید مواد مضر از قبیل آمونیاک، ایندول، فنلها و سولفید هیدروژن را که سرطانزا هستند و به کبد آسیب میرسانند مهار میکنند.. لاکتوباسیلوس اسیدوفیلوس هم نیتروزآمین را تجزیه میکند و میتواند تولید آن را در روده مهار کند. این دو باکتری قادرند تولید ایندول و رشد باکتریهای تولید کننده آن را کاهش دهند.
5- تقویت سیستم ایمنی.
6- تولید ویتامینها و سایر فاکتورهای غذایی.
7- اثرات سودمند از نظر تغذیه: ساخت مواد مغذی نظیر ویتامین B، K، آمینواسیدها، آنزیم لاکتاز، لیپاز و پروتئاز که از جمله آنزیمهای تولید شده هستند که هضم مواد غذایی را تسهیل می کنند.
انواع پروبیوتیکها شامل لاکتوباسیلوس1، بیفیدوباکتر2، باسیلوس3، پدیوکوکوس4، انتروکوکوس5 و مخمر ساکارومایسس سرویزیه6 هستند. باکتری لاکتوباسیلوس اسیدوفیلوس7 یکی از مفیدترین گونههای لاکتوباسیلوس میباشد که به عنوان یک میکرواورگانیسم پروبیوتیک در محصولات لبنی مانند ماست، شیر و بخشهایی از دستگاه گوارش پستانداران نظیر روده انسان دیده میشود (Jones, 1999; Gaspar et al.,2018 ).
در این پژوهش این باکتری جهت بیان کردن پپتید Tachyplesin I خرچنگ نعل اسبی مورد بررسی قرار میگیرد تا مشخص گردد چه تاثیری بر رشد سالمونلا دارد. باکتری سالمونلا، یک پاتوژن رودهای بی هوازی گرم منفی است که به طور طبیعی در دستگاه گوارش انسان و حیوانات وجود دارد و یکی از مهمترین عوامل باکتریایی منتقله از طریق غذا محسوب میگردد. ﮔﻮﻧـههـﺎي ﺳــﺎﻟﻤﻮﻧﻼ به ﻋﻨــﻮان ﻳﻜـی از ﻣﻬﻤﺘــﺮﻳﻦ آﻟــﻮده ﻛﻨﻨﺪههای ﻣﻮاد ﻏـﺬاﻳﻲ و از ﻋﻮاﻣـﻞ اﻳﺠـﺎد کننده ﮔﺎﺳﺘﺮواﻧﺘﺮﻳﺖ (اﻟﺘﻬﺎب ﻣﻌﺪي رودهای) در اﻧﺴﺎن ﺑـﻪ ﺷﻤﺎر میآﻳﻨﺪ. در ﺟﻨﺲ ﺳـﺎﻟﻤﻮﻧﻼ ﺑـﻴﺶ از 2600 ﺳﻮﻳﻪ وﺟـﻮد دارد که ﺑﺴـﻴﺎري از اﻳـﻦ ﺳـﻮیهها، ﭘـﺎﺗﻮژنهـﺎي ﻣﻬﻤـﻲ ﺑـﺮاي اﻧﺴـﺎنهـﺎ و ﺣﻴﻮاﻧـﺎت ﻣﺤﺴﻮب میﺷﻮﻧﺪ برای درﻣﺎن ﺑﯿﻤﺎریهای ﻧﺎﺷﯽ از ﺳـﺎﻟﻤﻮﻧﻼ از آﻧﺘـیﺑﯿﻮﺗﯿـکهـﺎ اﺳـﺘﻔﺎده ﻣـیﺷـﻮد؛ اﻣـﺎ ﺷـﯿﻮع ﻣﻘﺎوﻣﺖ ﺑﻪ آﻧﺘـیﺑﯿﻮﺗﯿـکﻫـﺎ در ﻣﯿـﺎن ﺳـﺎﻟﻤﻮﻧﻼها ﻣﺸـﮑﻞ اﺻـﻠﯽ در درﻣﺎن ﻋﻔﻮﻧتهای ﺳﺎﻟﻤﻮﻧﻼﯾﯽ اﺳـﺖ (Kolida et al.,2002). از علل افزایش مقاومت انتیبیوتیکی، ﻣﺼﺮف ﺑـﯽروﯾـﻪ و ﮐﻨﺘـﺮل ﻧﺸـﺪه آﻧﺘـیبیوﺗﯿـکها در اﻧﺴﺎن و ﺣﯿﻮان و ﮐﺎﻣـﻞ ﻧﮑـﺮدن دوره درﻣـﺎن ﺗﻮﺳـﻂ ﺑﯿﻤﺎر اﺳـﺖ ﮐـﻪ ﺑﺎﻋﺚ از ﺑﯿﻦ رﻓﺘﻦ ﺑﺎﮐﺘﺮیهاي ﺣﺴـﺎس و اﻧﺘﺨـﺎب ﺳـﻮیههـﺎي ﻣﻘـﺎوم میشود. ﻣﺎﻧﻨــﺪ ﺟﻮجههای ﮔﻮﺷﺘﯽ و ﺑﻮﻗﻠﻤـﻮن ﺑـﺮاي اﻓـﺰاﯾﺶ رﺷـﺪ، ﺳـﺒﺐ ﭘﯿـﺪاﯾﺶ ﺳـﺎﻟﻤﻮﻧﻼهای ﻣﻘﺎوم اﺳــﺘﻔﺎده از آنتیبیوتیکها در ﺑﺮﺧــﯽ از ﺣﯿﻮاﻧــﺎت ﺑﻪ آنتیبیوﺗﯿﮏ ﺷﺪه اﺳﺖ (Burns and Rowland, 2010). هدف از انجام این مطالعه ایجاد و بررسی اثرات پپتید Tachyplesin I خرچنگ نعل اسبی کلون شده در باکتری پروبیوتیک لاکتوباسیلوس اسیدوفیلوس بر رشد سالمونلا است.
روش کار
سویههای باکتریایی و وکتور
در این مطالعه تجربی، باکتري E. coli سویهTop10F که به منظور ترانسفورماسیون و تکثیر سازه ژنی نوترکیب مورد استفاده قرار گرفت از بخش بیوتکنولوژی دانشگاه آزاد اسلامی واحد شهرکرد تهیه گردید. باکتری لاکتوباسیلوس اسیدوفیلوس (PTCC No 1643) که به منظور بیان پروتئین Tachyplesin I مورد استفاده قرار گرفت، از مرکز کلکسیون قارچها و باکتریهای صنعتی ایران تهیه شد. باکتری سالمونلا انتریتیدس که به منظور بررسی اثرات پروبیوتیک مورد استفاده قرار گرفت، از بخش بیوتکنولوژی دانشگاه آزاد اسلامی واحد شهرکرد تهیه گردید. همچنین، پلاسمید نوترکیب pNZ8148-Tachyplesin I حامل ژنI Tachyplesin خرچنگ نعل اسبی به همراه سیگنال پپتید جهت ترشح پروتئین ساخته شده طراحی و به شرکت جینری سفارش داده شد.
ترانسفورماسیون و استخراج پلاسمید
باکتری E.coli سویه TOP10 یک شب در محیط کشتLuria–Bertani (LB) مایع در دمای 37 درجه سانتی گراد کشت داده شد. سلولهای مستعد8 به کمک کلسیم کلراید (CaCl2) و شوک حرارتی (42 درجه سانتیگراد) آماده شدند (Pimentel et al.,2020). از این سلولها برای انتقال پلاسمید نوترکیب pNZ8148-Tachyplesin I و پلاسمید خالی pNZ8148 به طور جداگانه استفاده شد. سپس باکتریها در محیط کشت LB Agar حاوی آنتی بیوتیک کلرامفنیکل کشت داده شدند. پلاسمید مورد استفاده ژن مقاومت به آنتیبیوتیک کلرامفنیکل را دارا میباشد. پودر کلرامفنیکل با غلظت 05/0 گرم در لیتر مورد استفاده قرار گرفت. در ابتدا 05/0 گرم از پودر کلرامفنیکل در 10 سی سی الکل خالص حل گردید سپس مقدار 1 سیسی از آن در هر 100 سیسی محیط کشت افزوده شد. به منظور استخراج پلاسمید ابتدا از ماتریکسها، درون 5 میلیلیتر محیط کشت LB-Broth حاوی کلرامفنیکل 05/0 گرم در لیتر، کشت داده شد و لوله به مدت 24 ساعت درون انکوباتور شیکردار قرار داده شد. سپس با استفاده از کیت استخراج پلاسمید شرکت یکتا تجهیز آزما (شرکت یکتا تجهیز آزما، تهران، ایران) طبق پروتکل کیت، پلاسمیدها استخراج گردید.
تایید صحت استخراج پلاسمید توسط واکنش PCR
واکنش PCR بر روی پلاسمید استخراج شده با استفاده از پرایمرهای اختصاصی (جدول 1) ژنI Tachyplesin انجام شد. در نهایت محصول آن روی ژل الکتروفورز برده شد و صحت استخراج پلاسمید بررسی شد.
رنگ آمیزی باکتری لاکتوباسیلوس اسیدوفیلوس
ابتدا از نمونه باکتری یک گسترش روی لام تهیه گردید. سپس رنگ آمیزی با کریستال ویوله انجام شد و مرحله رنگ بری با استفاده از استن – الکل به اینصورت انجام شد. سپس سطح گسترش با رنگ ثانویه یعنی سافرانین پوشانده شد و 30 تا 60 ثانیه زمان داده شد. بعد از آن رنگ اضافی خالی شد و با آب مقطر لام شستشو داده شد. لام رنگ آمیزی شده آهسته روی کاغذ خشک کن قرار داده شد.
الکتروپوریشن
باکتریهای لاکتوباسیلوس اسیدوفیلوس مورد نظر در محیط MRS مایع کشت داده شدند و به مدت 24 ساعت در دمای 37 درجه سانتیگراد انکوبه شدند. سه مرتبه به سلولها پالس داده شد (بین هر دو پالس کوت به مدت 5 دقیقه بر روی یخ قرار داده شد.). سلولهای باقی مانده بر روی پلیت حاوی محیط کشت MRS-Agar دارای آنتی بیوتیک کلرامفنیکل (05/0 گرم در لیتر) کشت داده شد.
تایید صحت انجام واکنش الکتروپوریشن
جهت تایید نهایی صحت الکتروپوریشن، از باکتریهای ترانسفورم شده مجددا استخراج پلاسمید انجام گرفت و بر روی پلاسمیدهای استخراج شده مجددا واکنش PCR به کمک پرایمرهایI Tachyplesin انجام شد.
استخراج RNA، تیمار با آنزیم DNaseI و سنتز cDNA
پس از تایید انتقال پلاسمید درون باکتری لاکتوباسیلوس اسیدوفیلوس، RNA تام سلولی از باکتریها استخراج شد. جهت استخراج RNA از میکروتیوب و سر سمپلرهای RNase Free/DNase Free استفاده شد. به این منظور از محلول RNX-Plus (سیناکلون، تهران، ایران) استفاده شد و RNA سلولی استخراج گردید و به میزان 25 میکرولیتر آب تزریق به تیوب اضافه شد تا رسوب RNA در آن حل گردید سپس DNase Treatment انجام شد. سنتز cDNA با استفاده از کیت سنتز cDNA یکتا تجهیز آزما انجام شد. به این منظور، میزان 10 میکرولیتر از نمونه RNA جهت حصول 500 نانوگرم از RNA، 1 میکرولیتر از پرایمر Random Hexamer (74 نانومول)، 4 میکرولیتر5 x first-strand buffer ، 1 میکرولیتر dNTPs (10 میلی مولار)، 5/0 میکرولیتر RNasin (40 واحد بر میکرولیتر) و 1 میکرولیتر M-MLV9 (200 واحد بر میکرولیتر) طبق پروتوکل کیت مورد استفاده قرار گرفت.
واکنش RT-PCR
صحت ساخت cDNA سنتز شده توسط واکنش PCR با پرایمرهای ژن Tachyplesin بررسی شد. محصولات PCR بر روی ژل آگارز %1 الکتروفورز گردید و پس از زمان مقرر با نور UV مشاهده شدند.
بررسی تاثیر ضد میکروبی باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده
جهت بررسی اثر ضد میکروبی باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده، باکتری سالمونلا روی محیط کشت مولر هینتون آگاردار کشت داده شد. سپس دیسک آنتی بیوگرام بلانک تهیه گردید و به باکتری مهندسی شده و غیر مهندسی شده آغشته گردید و بر روی سطح پلیت حاوی سالمونلا قرار داده شد. قطر هاله عدم رشد حاصل از باکتری لاکتوباسیلوس مهندسی شده با قطر هاله عدم رشد باکتری لاکتوباسیلوس سویه استاندارد دستکاری نشده و دیسکهای آنتی بیوتیکی نظیر آمپی سیلین، تتراسایکلین و کرامفنیکل پس از گذشت 24 ساعت مقایسه گردید.
آنالیز آماری
قطر هالههای عدم رشد حاصل از دیسکهای آنتیبیوتیکی آمپیسیلین، کلرامفنیکل، تتراسایکلین و همچنین باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده بر حسب میلیمتر اندازهگیری شد و سپس آنالیزهای مربوطه برای ایجاد باکتری پروبیوتیک لاکتوباسیلوس اسیدوفیلوس بیان کننده پپتید خرچنگ نعل اسبی و بررسی اثرات آن بر رشد سالمونلا با استفاده از نرم افزار Graphpad prism و آزمون های ANOVA TWO-Way انجام شد که سطح معنی داری 0.05 > Pدر نظر گرفته شد.
توسط نرم افزار GraphPad Prism آنالیز گردید.
جدول 1- اطلاعات پرایمر
Siz Bp | Primer sequence | Gene |
147 | Lp-Tach-F: 5’- ATGCGTAAAAAGTGGCGTTG -3’ Lp-Tach-R: 5’- ACGACAACGACGATAACAAATAC -3’ | Tachyplesin |
نتایج
نتایج تکثیر و استخراج پلاسمیدها
پلاسمید حاوی ژنI Tachyplesin، پلاسمید درون باکتری E.coli منتقل شد. پس از گذشت 24 ساعت از زمان انکوبه نمونهها، از تک کلنیهای رشد یافته ماتریکس تهیه گردید (شکل 1). سپس از ماتریکسها درون محیط LB-Broth حاوی آنتیبیوتیک کلرامفنیکل کشت داده شد و پلاسمید توسط کیت استخراج پلاسمید شرکت یکتا تجهیز آزما طبق دستورالعمل کیت، استخراج شد. واکنش PCR بر روی پلاسمیدهای استخراج شده با پرایمرهای ژنI Tachyplesin انجام شد. حضور باند 147 جفت بازیI Tachyplesin، صحت انجام استخراج پلاسمید را تایید کرد (شکل 2).
شکل 1- ترانسفکت پلاسمید و تهیه ماتریکس از تک کلنیهای رشد یافته.
شکل 2- واکنش PCR بر روی پلاسمید pNZ8148-Tachyplesin I استخراج شده. حضور باند 147 جفت بازی مربوط به ژن Tachyplesin (B) در کنار مارکر 50 جفت بازی (A) صحت استخراج پلاسمید را تایید کرد. چاهک C کنترل منفی.
شکل 3- تایید خلوص باکتری لاکتوباسیلوس اسیدوفیلوس. پس از رنگ آمیزی گرم، باسیل¬های باکتری زیر میکروسکوپ رویت شدند.( بزرگنمایی 40x)
نتایج الکتروپوریشن
پس از انجام واکنش الکتروپوریشن، باکتری لاکتوباسیلوس اسیدوفیلوس بر روی محیط MRS-Agar حاوی 05/0 گرم در لیتر آنتیبیوتیک کلرامفنیکل کشت داده شد. از تک کلنیها، ماتریکس تهیه گردید (شکل 4). سپس از ماتریکسهای رشد یافته مجددا استخراج پلاسمید انجام گرفت و واکنش PCR مجددا بر روی پلاسمید استخراج شده با پرایمرهای ژنI Tachyplesin انجام شد. صحت انجام واکنش الکتروپوریشن مجددا با رویت باند 147 جفت بازیI Tachyplesin تایید گردید (شکل 5).
شکل 4- تهیه ماتریکس از باکتری استافیلوکوکوس اسیدوفیلوس نوترکیب. 24 ساعت پس از انجام الکتروپوریشن، از تک کلنی¬های حاصل ماتریکس تهیه گردید.
شکل 5- واکنش PCR بر روی پلاسمید استخراج شده از باکتری لاکتوباسیلوس اسیدوفیلوس نوترکیب. حضور باند 147 جفت بازی مربوط به ژن Tachyplesin (B) در کنار مارکر 100 جفت بازی (A) صحت انجام الکتروپوریشن را تایید کرد. چاهک c: کنترل منفی.
نتایج استخراج RNA و سنتز cDNA
باکتری لاکتوباسیلوس اسیدوفیلوس نوترکیب درون محیط کشت LB-Broth حاوی 05/0 گرم در لیتر آنتیبیوتیک کلرامفنیکل کشت داده شد. RNA تام استخراج گردید و cDNA سنتز شد. واکنش PCR تکرار شد، به اینصورت که بر روی cDNA ساخته شده با پرایمرهای ژنI Tachyplesin واکنش PCR انجام شد و پس از الکتروفورز باند 147 جفت بازیI Tachyplesin رویت شد در نتیجه بیان زهرI Tachyplesin تایید گردید (شکل 6).
شکل 6- بررسی صحت سنتز cDNA به روش PCR. باند 147 جفت بازی (B) مربوط به ژنI Tachyplesin در کنار مارکر 100 جفت بازی (A) صحت سنتز cDNA را تایید کرد. چاهک C کنترل منفی است.
نتایج مربوط به بررسی تاثیر ضد میکروبی باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده
باکتری سالمونلا بر روی محیط کشت مولر هینتون آگاردار کشت داده شده. سپس دیسکهای آنتیبیوگرام بلانک تهیه گردید و به باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده و لاکتوباسیلوس اسیدوفیلوس مهندسی نشده آغشته گردید و بر روی پلیت حاوی باکتری سودوموناس آئروژینوزا قرار داده شد. علاوه بر این، دیسکهای آنتیبیوتیک آمپیسیلین، تتراسایکلین و کرامفنیکل نیز در کنار دو گروه قبلی قرار داده شد. پس از گذشت 24 ساعت از انکوباسیون در دمای 37 درجه سانتی گراد هالههای اطراف دیسک ها مشاهده شد. همانطور که در تصویر 7 مشاهده میشود اطراف دیسک حاوی باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده هاله قابل قبولی تشکیل شده است که نشان میدهد سمI Tachyplesin تولید شده و پس از ترشح از باکتری لاکتوباسیلوس، بر روی باکتری سالمونلا اثر مهاری داشته است و اثری مشابه با آنتیبیوتیکهای آمپیسیلین، تتراسایکلین و کرامفنیکل داشته است. این در حالی است که باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی نشده تاثیری بر رشد باکتری سالمونلا نداشته است (شکل 7).
شکل 7- تشکیل هاله اطراف دیسک. A: هاله حاصل از لاکتوباسیلوس اسیدوفیلوس نوترکیب در مقایسه با لاکتوباسیلوس اسیدوفیلوس غیر نوترکیب. B: هالههای حاصل از دیسکهای آنتیبیوتیکی آمپیسیلین، تتراسایکلین و کرامفنیکل.
شکل 8- نتایج تشکیل هاله اطراف دیسک. A: هاله حاصل از لاکتوباسیلوس اسیدوفیلوس نوترکیب در مقایسه با لاکتوباسیلوس اسیدوفیلوس غیر نوترکیب. B: هاله¬های حاصل از دیسک¬های آنتی¬بیوتیکی آمپی-سیلین، تتراسایکلین و کرامفنیکل. C: اطراف دیسک حاوی باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده هاله قابل قبولی تشکیل شده است.
نتایج
قطر هالههای عدم رشد اطراف دیسکهای آمپیسیلین، تتراسایکلین، کلرامفنیکل و باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده با خط کش در مقیاس میلیمتر اندازهگیری گردید و نتایج توسط نرم افزار GraphPad Prism آنالیز گردید. آزمون بررسی قطر هاله به صورت دو تکرار انجام شد. از نظر آماری اختلاف بین هاله عدم رشد آمپیسیلین، تتراسایکلین و کلرامفنیکل با هاله عدم رشد حاصل از لاکتوباسیلوس اسیدوفیلوس مهندسی شده معنیدار نبود. در واقع بر اساس این نتایج میتوان ادعا کرد که هالههای عدم رشد حاصل از باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی شده تفاوت آماری معنیداری با هالههای عدم رشد دیسکهای آنتیبیوتیکی نشان ندادند (شکل 9) (جدول 2).
شکل 9- نتایج مربوط به آنالیز آماری قطر هالههای عدم رشد. پس از آنالیز اختلاف آماری بین هاله عدم رشد باکتری مهندسی شده و دیسکهای آنتیبیوتیکی مشاهده نشد (Blank control باکتری لاکتوباسیلوس اسیدوفیلوس مهندسی نشده است).
جدول 2- قطر هالههای عدم رشد بر روی پلیت
باکتری | قطر هاله | |||||||||
Salmonella enteritidis | Ampicillin | Tetracycline | Chloramphenicol | Lactobacillus-Tachyplesin | Blank control | |||||
| 15.12 | 13.84 | 12.54 | 13.23 | 15.43 | 15.99 | 2.33 | 3.65 | 0.86 | 0.73 |
بحث
پروبیوتیکها میکروارگانیسمهای غیر بیماریزایی هستند که اگر به تعداد کافی و به صورت زنده مورد استفاده قرار گیرند، از طریق ایجاد تعادل میکروبی در روده اثرات مفید و سلامت بخشی برای میزبان خود دارند. گزارش شده است که لاکتوباسیلوس اسیدوفیلوس در تنظیم ژنهای مرتبط با پاسخ ایمنی، تنظیم هورمونی رشد و نمو بافت و هموستاز یونی دخیل است. افزون بر این گزارش شده است که استفاده از پروبیوتیکها تاثیر سودمندی روی عملکرد، بهبود تعادل میکروبی، سنتز ویتامینها، کاهش PH، رها سازی باکتریسینها و بهبود مصرف غذا در جوجههای گوشتی و مرغهای تخمگذار دارد (Shirzadi et al.,2019).
با توجه به اینکه موضوع این پژوهش بررسی اثرات باکتری پروبیوتیک لاکتوباسیلوس اسیدوفیلوس بیان کننده پپتید Tachyplesin I خرچنگ نعل اسبی بر رشد سالمونلا بود به همین منظور، ژنI Tachyplesin به صورت سنتتیک درون پلاسمید pNZ8148 قرار داده شد. آنالیزهای آماری نشان داد که این اختلاف معنیداری بین هالههای عدم رشد حاصل از دیسکهای آنتیبیوتیک آمپیسیلین، تتراسایکلین و کلرامفنیکل با هاله عدم رشد حاصل از لاکتوباسیلوس اسیدوفیلوس مهندسی شده وجو ندارد و فرضیه تحقیق قابل قبول بود. در واقع نتایج بدست آمده از این تحقیق نشان داد که پروتئین ترشحی Tachyplesin I که توسط باکتری پروبیوتیک لاکتوباسیلوس اسیدوفیلوس مهندسی شده تولید میگردد میتواند اثر مهاری بر رشد باکتری سالمونلا بگذارد. لاکتوباسیلوس اسیدوفیلوس و ترکیب آن با آنتی بیوتیکهای طبیعی اثرات مثبتی بر عملکرد رشد، اکولوژی میکروبی روده، و مورفولوژی روده جوجههای گوشتی نشان داده و میتواند به عنوان یک محرک رشد استفاده شود (Atabaigi et al.,2020). در مطالعات گذشته نشان داده شده است که افزایش مقاومت به سالمونلا ناشی از درمان با لاکتوباسیلوس کازئی و لاکتوباسیلوس اسیدوفیلوس در شیر تخمیر شده با اسیدوفیلوس به دلیل ایمنی محافظتی ضد سالمونلا است که عمدتاً توسط بافت مخاطی ایجاد می شود(Shirzadi et al.,2019). در دهههای اخیر نشان داده شده که پروبیوتیکهای حاصل از فلور طبیعی روده باعث کاهش عفونتهای باکتریایی روده میشود. علاوه بر این پروبیوتیکها از چسبیدن مواد سمی به دیواره روده جلوگیری میکنند. پروبیوتیکها از روده در برابر تشکیل ترکیبان سرطانزا محافظت میکنند. مطالعات اخیر نشان میدهد که پروبیوتیکهای لاکتوباسیلی درمان سرطان کولورکتال را با استفاده از 5-FlouroUracile تسهیل میکنند. استفاده از پروبیوتیکها گزینه خوبی برای پیشگیری از بدخیمیهای دستگاه گوارش، به خصوص سرطانهای روده بزرگ میباشد. عمل ضد سرطانی پروبیوتیکها ممکن است به دلیل مکانیسمهای مختلفی از جمله اثرات ضد سرطان و یا ضد سرطانزا، ضد جهشزا، تغییر و تمایز در تومور، تغییر تحرک کولون و زمان عبور و همچنین کاهش pH روده برای کاهش فعالیت میکروبی باشد. باکتریهای پروبیوتیک با الیگوساکاریدها میتواند رشد باکتری در روده بزرگ را افزایش دهد و منجر به مقادیر بیشتر اسیدهای چرب با زنجیره کوتاه مانند بوتیرات که اثرات ضد توموری دارد شوند (Kailasapathy et al.,2000). مطالعات قبلی اثرات مهاری گونههای لاکتوباسیلوس را در برابر رشد اشریشیا کلی، استافیلوکوکوس اورئوس، لیستریا مونوسیتوژنز، شیگلا فلکسنر، سالمونلا تیفی موریوم، انتروباکتر کلوآکا، سودوموناس آئروژینوزا و انتروکوکوس فکالیس نشان دادهاند و نیز فعالیت آنتاگونیستی جدایههای لاکتوباسیلوس علیه سالمونلا تیفی در شرایط آزمایشگاهی نشان داده شده است (Abdel et al.,2013).
Maragkoudakis et al.(2009) خواص عملکردی باکتریهای اسید لاکتیک بر علیه لیستریا مونوسیتوژنز و سالمونلا انتریتیدیس جهت حافظت گوشت مرغ خام در محیط آزمایشگاهی را ارئه دادند. از سویی دیگر، آلودگي به سالمونلا در پرندگان به وفور گزارش شده است. بيماري سالمونلوزیز در پرندگان و به ويژه مرغ اسهال سفيد باسيلي (پولوروم) است كه عامل آن سالمونلا پولوروم ميباشد. سالمونلا پولوروم علاوه بر مرغ از قرقاول، قناري، طوطي، گوساله، خوك، اسب، گربه و انسان نيز جدا شده است. اين سروتيپ براي جوجهها در چند روز اول زندگي بسيار كشنده است ولي مرغها معمولاً نسبت به آن مقاومت دارند. باکتری در تخمدان پرندگان ميماند و از طريق تخممرغ به جوجهها منتقل ميشود. بيماري با اسهال و سپتي سمي همراه است و تعداد زيادي باكتري از طريق مدفوع جوجههاي مبتلا دفع شده و باعث آلودگي محيط و در نتيجه ابتلاي ساير جوجهها ميشود (Safarpour et al.,2020).
نتیجهگیری
Tachyplesin -، یک پپتید ضد میکروبی است که این پپتید از طریق آپوپتوز، پرولیفراسیون تومور کشت داده شده را خاموش میکند. Tachyplesi کاتیونیک هپارین است و به معروف بودن آن به دلیل طيف وسيع و خواص آنتی میکروبیال قوی در برابر باکتریهای مقاوم به داروها است و همچنین از طریق واکنش با غشا لیپیدی باکتریها موجب افزایش نفوذ پذیری غشا میشود که این موضوع سبب مرگ باکتریها شده است. به دلیل معرفی شدن آن به عنوان یک گزینه جهت داروهای ضد میکروبی، ضد تومور و ضد ویروس، طيف وسيع در برابر باکتریهای گرم مثبت و گرم منفی است. با توجه به نتایج حاصل از آنالیز آماری و همچنین مشاهدات میکروسکوپی کشت میکروبی، میتوان چنین اعلام کرد که ژنI Tachyplesin پس از بیان شدن درون باکتری پروبیوتیک لاکتوباسیلوس اسیدوفیلوس، توانایی ترشح به خارج از سلول را پیدا کرده و بر روی رشد باکتری سالمونلا تاثیر میگذارد. در واقع، بر طبق نتایج این پژوهش، بیان ژن زهرI Tachyplesin در باکتری لاکتوباسیلوس اسیدوفیلوس، قادر این رشد باکتری سالمونلا را مهار کند و تاثیری شبیه به آنتیبیوتیکهایی نظیر آمپیسیلین، تتراسایکلین و کلرامفنیکل داشته باشد.
منابع
Abdel D.A., Hassouna N., Hafez M., Ashor M.S., Aboulwafa M.M. 2013. Antagonistic activity of Lactobacillus isolates against Salmonella typhi in vitro. BioMed rResearch iInternational. 233: 685-696.
Atabaigi E.V., Moradi s., Ghazi Sh ., Rahimi M. 2020. Effects of Lactobacillus acidophilus and natural antibacterials on growth performance and Salmonella colonization in broiler chickens challenged with Salmonella enteritidis. Livestock Science. 233: 103-114.
Burns A.J. and Rowland I.R. 2010. Anti carcinogenicity of probiotics and prebiotics. Intestinal mMicrobiology. 1: 13-24.
Gaspar C., Donders G.G., Palmeirade O.R., Queiroz J.A., Tomaz C., Martinezde O.J., Palmeirade O.A. 2018. Bacteriocin production of the probiotic Lactobacillus acidophilus KS400. Applied Microbiology and Biotechnology Express. 8: 1-8.
Jay J.M. 2012. Modern Food Microbiology. Springer Science & Business Media. Gaithersburg, Maryland, USA.
Jones F. 1999. Lactobacillus acidophilus. University of Wisconsim-Madison, Department of Bacteriology. London, U.K.
Kailasapathy K. and Chin J. 2000. Survival and therapeutic potential of probiotic organisms with reference to Lactobacillus acidophilus and Bifidobacterium spp. Immunol Cell Biology. 78: 80-8.
Kolida S., Tuohy K., Gibson G.R.2002. Prebiotic effects of inulin and oligofructose. British J.ournal of Nutrition. 87: 193-7.
Maragkoudakis P.A., Mountzouris K.C., Psyrras D., Cremonese S., Fischer J., Cantor MD., Tsakalidou E.2009. Functional properties of novel protective lactic acid bacteria and application in raw chicken meat against Listeria monocytogenes and Salmonella enteritidis. Int. J. of Food Microbiology. 130: 219-226.
Pimentel T.C., Madrona G.S., Garcia S., Prudencio S.H. 2020. Probiotic viability, physicochemical characteristics and acceptability during refrigerated storage of clarified apple juice supplemented with Lactobacillus paracasei ssp. paracasei and oligofructose in different package type. Lebensmittel-Wissenschaft & Technologie. Food Science and Technology.63: 415-422.
Safarpour D.M., Doosti A., Jami M.S. 2020. Impacts of the Staphylococcal Enterotoxin H on the Apoptosis and lncRNAs in PC3 and ACHN. Molecular Genetics, Microbiology and Virology. 35: 180-8.
Shirzadi H., Nasermanesh H., Khatibjoo A., Taherpour K., Akbari Gharaei M. 2019. ٍEffect of sweet wormwood essence and Lactobacillus acidophilus on performance of Japanese quails in laying period. Animal Production. 21: 151-63.
Tufarelli V. and Laudadio V. 2016. An overview on the functional food concept: prospectives and applied researches in probiotics, prebiotics and synbiotics. J. of Experimental Biology and Agricultural Science. 4: 273-278.
Investigation of the inhibitory effect of engineered probiotic Lactobacillus acidophilus on the growth of Salmonella enteritidis
Abstract
Probiotics are living cellular components that have beneficial effects on the host in a certain number when they enter the gastrointestinal tract. The aim of this study was to produce and evaluate the effects of the probiotic bacterium Lactobacillus acidophilus, which expresses the peach's peptide Tachyplesin I, on the growth of Salmonella. The recombinant plasmid pNZ8148- Tachyplesin containing the Tachyplesin gene was introduced into E. coli by heat shock and then purified. The recombinant vector containing the tachiplicin gene was then inserted into Lactobacillus acidophilus by electroporation method and screened by chloramphenicol antibiotic and PCR. Then, the inhibitory effect of engineered Lactobacillus acidophilus on the growth of Salmonella was investigated and compared with antibiotic discs..After confirmation of the entry of plasmid pNZ8148-Tachyplesin into Lactobacillus acidophilus, it had an inhibitory effect on the growth of Salmonella pathogenic bacterium as the diameter of the growth inhibition zone created on Salmonella was acceptable under the influence of engineered Lactobacillus. After comparing the diameter of the auras of ampicillin, chloramphenicol and tetracycline antibiotic disks with engineered lactobacillus and performing statistical analysis, no significant difference was reported. Considering that the presence of Tachyplesin gene in Lactobacillus acidophilus was confirmed, the resulting growth inhibition zone around Salmonella indicates that the expression and secretion of Tachyplesin gene in Lactobacillus has an antibiotic-like effect on Salmonella.
Keywords: Lactobacillus acidophilus, Salmonella, Tachyplesin
[1] Lactobacillus
[2] Bifidobacterium
[3] Bacillus
[4] Pediococcus
[5] Enterococcus
[6] Saccharomyces cerevisiae
[7] lactobacillus acidophilus
[8] Competent Cell
[9] Moloney Murine Leukemia Virus Reverse Transcriptase