فراوانی ژن های omp T، iss وpap GII در اشریشیاکلی های جدا شده از موارد کلی باسیلوز طیور در شهر تبریز
محورهای موضوعی : باکتری شناسی
فرناز جعفری
1
,
سامان مهدوی
2
*
1 - کارشناسی ارشد، گروه میکروبیولوژی، واحد مراغه، دانشگاه آزاد اسلامی، مراغه، ایران
2 - دانشیار، گروه میکروبیولوژی، واحد مراغه، دانشگاه آزاد اسلامی، مراغه، ایران
کلید واژه: اشریشیاکلی, کلی باسیلوز طیور, ژن های حدت,
چکیده مقاله :
کلیباسیلوز یکی از بیماریهای بسیار شایع در صنعت پرورش طیور میباشد که سالیانه موجب بروز خسارات اقتصادی زیادی میگردد. هدف از انجام این تحقیق، بررسی فراوانی ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور در شهر تبریز بود. 100 نمونه باکتری اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور (در سال 1400) با روشهای بیوشیمیایی و رنگآمیزی بصورت فنوتیپی تعیین هویت شدند. سپس فراوانی ژنهای iss، omp T و pap GII در این جدایهها به روش Multiplex PCR مورد بررسی قرار گرفت. نتایج نشان داد که فراوانی ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی مورد آزمایش بترتیب 33 درصد، 14 درصد و 22 درصد بود. همچنین یک درصد از جدایههای مورد آزمایش حاوی هر سه ژن مذکور بودند. 23 نمونه منفی از نظر حضور ژنهای مورد مطالعه مشاهده شد. با توجه به حضور ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی جدا شده از طیور میتوان نتیجهگیری کرد که این ژنها میتوانند به عنوان عوامل موثر در عفونتهای خارج رودهای باکتری مطرح باشند. همچنین ژن iss به دلیل دارا بودن بیشترین میزان فراوانی در بین ژنهای مورد مطالعه، با احتمال بیشتری میتواند بطور بالقوه به عنوان مهمترین عامل بیماریزایی در اشریشیاکلیهای جدا شده از طیور معرفی شود.
Colibacillosis is one of the most common diseases in the poultry industry, which causes a lot of economic losses every year. The aim of this research was to study of the frequency of omp T, iss and pap GII genes in Escherichia coli isolated from poultry colibacillosis in Tabriz city. 100 samples of Escherichia coli isolated from poultry colibacillosis (in 2021) were phenotypically identified by biochemical and staining methods. Then, the frequency of omp T, iss and pap GII genes in these isolates was investigated by Multiplex PCR method. The results showed that the frequency of iss, omp T and pap GII genes in the tested Escherichia coli samples were 33%, 14% and 22%, respectively. Also, 1% of the tested isolates contained all three mentioned genes simultaneously. 23 negative samples were observed in terms of the presence of studied genes. Considering the presence of iss, omp T and pap GII genes in Escherichia coli isolated from poultry, it can be concluded that these genes can be effective factors in the extraintestinal infections. Also, iss gene, due to having the highest frequency among the studied genes, can potentially be introduced as the most important pathogenic factor in Escherichia coli isolated from poultry.
Abd El-Hady, A. M., Elghalid, O. A., Elnaggar, A. S., & Abd El-khalek, E. (2022). Growth performance and physiological status evaluation of Spirulina platensis algae supplementation in broiler chicken diet. Livestock Science, 263, 105009.
Abed, S., Nowruzi, B., & Anvar, S. A. A. (2025). Production of Oncorhynchus mykiss biosensor based on polyvinyl alcohol/chitosan nanocomposite using phycocyanin during refrigerated storage. Scientific reports, 15(1), 703.
Abouelezz, F. (2017). Evaluation of spirulina algae (Spirulina platensis) as a feed supplement for japanese quail: nutiritional effects on growth performance, egg production, egg quality, blood metabolites, sperm-egg penetration and fertility. Egyptian Poultry Science Journal, 37(3), 707-719.
Ahmadi, A., Anvar, S. A. A., Nowruzi, B., & Golestan, L. (2024). Effect of phycocyanin and phycoerythrin on antioxidant and antimicrobial activity of refrigerated low-fat yogurt and cream cheese. Scientific reports, 14(1), 27661.
Al-Batshan, H. A., Al-Mufarrej, S. I., Al-Homaidan, A. A., & Qureshi, M. (2001). Enhancement of chicken macrophage phagocytic function and nitrite production by dietary Spirulina platensis. Immunopharmacology and immunotoxicology, 23(2), 281-289.
Al-Khalaifah, H. S., Al-Nasser, A., & Surrayai, T. (2022). Effects from dietary addition of sargassum sp., spirulina sp., or gracilaria sp. powder on immune status in broiler chickens. Frontiers in Veterinary Science, 9, 928235.
Alaqil, A. A., & Abbas, A. O. (2023). The effects of dietary Spirulina platensisis on physiological responses of broiler chickens exposed to endotoxin stress. Animals, 13(3), 363.
Alibabai, M., Khajeh-Rahimi, A.-E., & Nowruzi, B. (2023). A review of recent developments in the use of cyanobacteria and microalgae in improving the quality and increasing the shelf life of seafood products.
Alwaleed, E. A., El-Sheekh, M., Abdel-Daim, M. M., & Saber, H. (2021). Effects of Spirulina platensis and Amphora coffeaeformis as dietary supplements on blood biochemical parameters, intestinal microbial population, and productive performance in broiler chickens. Environmental Science and Pollution Research, 28, 1801-1811.
Anvar, A., & Nowruzi, B. (2021). Bioactive properties of spirulina: A review. Microb. Bioact, 4, 134-142.
Anvar, S., & Nowruzi, B. (2022). A review of microalgae as dietary and medicinal useful complements.
Anvar, S. A. A., Nowruzi, B., & Afshari, G. (2023). A review of the application of nanoparticles biosynthesized by microalgae and cyanobacteria in medical and veterinary sciences.
Behjati, M., Ataee, M., Nowruzi, B., Anvar, S. A. A., & Ahari, H. (2025). STUDYING THE ANTIOXIDANT AND ANTIMICROBIAL ACTIVITY OF PHYCOERYTHRIN TO INCREASE THE SHELF LIFE OF HAMBURGERS AT REFRIGERATOR TEMPERATURE. Journal of microbiology, biotechnology and food sciences, 14(5), e11625-e11625.
Bonos, E., Kasapidou, E., Kargopoulos, A., Karampampas, A., Nikolakakis, I., Christaki, E., & Florou-Paneri, P. (2016). Spirulina as a functional ingredient in broiler chicken diets. South African Journal of Animal Science, 46(1), 94-102.
Bortolini, D. G., Maciel, G. M., Fernandes, I. d. A. A., Pedro, A. C., Rubio, F. T. V., Branco, I. G., & Haminiuk, C. W. I. (2022). Functional properties of bioactive compounds from Spirulina spp.: Current status and future trends. Food Chemistry: Molecular Sciences, 5, 100134.
Chamari, M., Anvar, S. A. A., Pourahmad, R., Nowruzi, B., & Yousefi, S. (2024). Study of alginate-encapsulated phycoerythrin in promoting the biological activity of synbiotic ice cream with Lactobacillus casei. Scientific reports, 14(1), 15471.
Chen, Y.-Y., Chen, J.-C., Tayag, C. M., Li, H.-F., Putra, D. F., Kuo, Y.-H., . . . Chang, Y.-H. (2016). Spirulina elicits the activation of innate immunity and increases resistance against Vibrio alginolyticus in shrimp. Fish & shellfish immunology, 55, 690-698.
El-Shall, N. A., Jiang, S., Farag, M. R., Azzam, M., Al-Abdullatif, A. A., Alhotan, R., . . . Alagawany, M. (2023). Potential of Spirulina platensis as a feed supplement for poultry to enhance growth performance and immune modulation. Frontiers in Immunology, 14, 1072787.
Elbaz, A. M., Ahmed, A. M., Abdel-Maqsoud, A., Badran, A. M., & Abdel-Moneim, A.-M. E. (2022). Potential ameliorative role of Spirulina platensis in powdered or extract forms against cyclic heat stress in broiler chickens. Environmental Science and Pollution Research, 29(30), 45578-45588.
Fathi, M. A. (2018). Effect of dietary supplementation of algae meal (Spirulina platensis) as growth promoter on performance of broiler chickens. Egyptian Poultry Science Journal, 38(2), 375-389.
Hajati, H., & Zaghari, M. (2019). Effects of Spirulina platensis on growth performance, carcass characteristics, egg traits and immunity response of Japanese quails. Iranian Journal of Applied Animal Science, 9(2), 347-357.
Holman, B., & Malau‐Aduli, A. (2013). Spirulina as a livestock supplement and animal feed. Journal of animal physiology and animal nutrition, 97(4), 615-623.
Iry, N., Nowruzi, B., & Ghazi, S. (2023). Study of the effect of phycocyanin pigment on physicochemical, sensory, microbial and antioxidant properties of cheese. Research and Innovation in Food Science and Technology, 12(1), 55-76.
Jamil, A. R., Akanda, M. R., Rahman, M. M., Hossain, M. A., & Islam, M. S. (2015). Prebiotic competence of Spirulina on the production performance of broiler chickens.
Kaoud, H. A. (2015). Effect of Spirulina platensis as a dietary supplement on broiler performance in comparison with prebiotics. specialty journal of biological sciences, 1(2-2015), 1-6.
Kashi, M. S., Ghazi, S., & Nowruzi, B. (2024). Industrial application of Natural Phycocyanin Edible Pigment isolated from Spirulina platensis in Preparation of fortified ice cream with emphasize on microbial and antioxident properties. Iranian journal of food science and industry, 21(149).
Khan, S., Mobashar, M., Mahsood, F. K., Javaid, S., Abdel-Wareth, A., Ammanullah, H., & Mahmood, A. (2020). Spirulina inclusion levels in a broiler ration: evaluation of growth performance, gut integrity, and immunity. Tropical Animal Health and Production, 52, 3233-3240.
Kharde, S., Shirbhate, R., Bahiram, K., & Ahmadi, M., Dadashzadeh, S., Ghaniei, A. (2019). Prevalence of virulence genes in Escherichia coli isolates implicated in poultry colibacillosis and human urinary tract infection. Journal of Veterinary Microbiology, 15(1): 109-118. (In Persian)
Akond, M. A., Alam, S., Hassan, S. M. R., Shirin, M. (2015). Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of Bangladesh. Internet Journal of Food Safety, 11: 19-23ce.
Azizpour, A. (2022). A survey of Escherichia coli contamination in eggs of Ardabil and determination of their antibiotic resistance. Veterinary Researches and Biological Products, 34(4): 112-120. (In Persian)
Azizpour, A., Ghazaei, C. (2020). Evaluation of antibiotic resistance pattern of Escherichia coli isolated from broiler chickens with colibacillosis in Ardabil Province, Iran. International Journal of Basic Science in Medicine, 5(4):125- 130.
Bauchart, P., Germon, P., Bree, A., Oswald, E., Hacker, J., Dobrindt, U. (2010). Pathogenomic comparison of human extraintestinal and avian pathogenic Escherichia coli--search for factors involved in host specificity or zoonotic potential. Microbial Pathogenesis, 49(3): 105-115.
Chuba, P. J., Leon, M. A., Banerjee, A., Palchaudhuri, S. (1989). Cloning and DNA sequence of plasmid determinant iss, coding for increased serum survival and surface exclusion, which has homology with lambda DNA. Molecular and General Genetics, 216: 287–292.
Cortés, P., Blanc, V., Mora, A., Dahbi, G., Blanco, J. E., Blanco, M. (2010). Isolation and characterization of potentially pathogenic antimicrobial-resistant Escherichia coli strains from chicken and pig farms in Spain. Applied and Environmental Microbiology, 76(9):2799-2805.
Dissanayake, D. R., Wijewardana, T. G., Gunawardena, G. A., Poxton, I. R. (2008). Distribution of lipopolysaccharide core types among avian pathogenic Escherichia coli in relation to the major phylogenetic groups. Veterinary Microbiology, 132: 355-363.
Ghanbarpour, R., Salehi, M., Oswald, E. (2010). Virulence genotyping of Escherichia coli isolates from avian cellulitis in relation to phylogeny. Comparative Clinical Pathology, 19: 147-153.
Ghorbani, A. R., Khoshbakht, R., Kaboosi, H., Shirzad- Aski, H., Peyravii Ghadikolaii, F. (2021). Phylogenetic relationship and virulence gene profiles of avian pathogenic and uropathogenic Escherichia coli isolated from avian colibacillosis and human urinary tract infections (UTIs). Iranian Journal of Veterinary Research, 22(3): 203-208.
Jantunen, M. E., Siitonen, A., Koskimies, O., Wikstrom, S., Karkkainen, U., Salo, E., Saxen, H. (2000). Predominance of class II papG allele of Escherichia coli in pyelonephritis in infants with normal urinary tract anatomy. Journal of Infectious Diseases, 181: 1822–1824.
Jeffrey, J., Nolan, L., Tonooka, K., Wolfe, S., Giddings, C., Horne, S. (2002). Virulence factors of Escherichia coli from cellulitis or colisepticemia lesions in chickens. Avian diseases, 46(1):48-52.
Johnson, T. J., Wannemuehler, Y., Doetkott, C., Johnson, S. J., Rosenberger, S. C., Nolan, L. K. (2008). Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. Journal of Clinical Microbiology, 46: 3987- 3996.
Johnson, T. J., Wannemuehler, Y. M., Nolan, L. K. (2008). Evolution of the iss gene in Escherichia coli. Applied and Environmental Microbiology, 74(8):2360-9.
Kafshdouzan, Kh., Zahraei-Salehi, T., Nayeri, B., Madadgar, O., Yamasaki, S., Hinenoya, A., Yasuda, N. (2013). Distribution of virulence associated genes in isolated Escherichia coli from avian colibacillosis. Iranian Journal of Veterinary Medicine, 7(1): 1-6.
Kwon, S. G., Cha, S. Y., Choi, E. J., Kim, B., Song, H. J., Jang, H. K. (2008). Epidemiological prevalence of avian pathogenic Escherichia coli differentiated by multiplex PCR from commercial chickens and hatchery in Korea. Journal of Bacteriology and Virology, 38(4): 179-188.
Mellata, M. (2013). Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathogens and Diseases, 10:916–932.
Mokady, D., Gophna, U., Ron, E. Z. (2005). Extensive gene diversity in septicemic Escherichia coli strains. Journal of Clinical Microbiology, 43(1): 66-73.
Monroy, M. A., Kno¨bl, T., Bottino, J. A., Ferreira, C. S., Ferreira, A. J. (2005) Virulence characteristics of Escherichia coli isolates obtained from broiler breeders with salpingitis. Comparative Immunology, Microbiology and Infectious Diseases, 28: 1-15.
Moulin-Schouleur, M., Schouler, C., Tailliez, P., Kao, M. R, Brée, A., Germon, P., Oswald, E., Mainil, J., Blanco, M., Blanco, J. (2006). Common virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. Journal of Clinical Microbiology, 44(10): 3484-3492.
Najafi, S., Rahimi, M., Nikousefat, Z. (2019). Extra-intestinal pathogenic Escherichia coli from human and avian origin: Detection of the most common virulence-encoding genes. Veterinary Research Forum, 10(1): 43-49.
Nakazato, G., de Campos, T. A., Stehling, E. G., Brocchi, M., da Silveira, W. D. (2009). Virulence factors of avian pathogenic Escherichia coli (APEC). Pesquisa Veterinaria Brasileira, 29(7): 479-486.
Nateghi, F., Jafarpour, M., Nazemi, A. (2010). A survey for detection of eight correlated genes of avian pathogenic Escherichia coli in human uropathogenic Escherichia coli. Journal of Microbial World, 3(3): 169-176. (In Persian)
Okuno, K., Yabuta, M., Ooi, T., Kinoshita, S. (2004). Utilization of Escherichia coli outer-membrane endoprotease ompT variants as processing enzymes for production of peptides from designer fusion proteins. Applied and Environmental Microbiology, 70: 76-86.
Rodriguez-Siek, K. E., Giddings, C. W., Doetkott, C., Johnson, T. J., Fakhr, M. K., Nolan, L. K. (2005). Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiology, 151:2097– 2110.
Russo, T. A., Johnson, J. R. (2003). Medical and economic impact of extraintestinal infections due to Escherichia coli: focus on an increasingly important endemic problem. Microbes and Infection, 5:449-456.
Sunwoo, H. H, Wang, W. W, Sim, J. S. (2006). Detection of Escherichia coli O157 Ahmadi, M., Dadashzadeh, S., Ghaniei, A. (2019). Prevalence of virulence genes in Escherichia coli isolates implicated in poultry colibacillosis and human urinary tract infection. Journal of Veterinary Microbiology, 15(1): 109-118. (In Persian)
Akond, M. A., Alam, S., Hassan, S. M. R., Shirin, M. (2015). Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of Bangladesh. Internet Journal of Food Safety, 11: 19-23ce.
Azizpour, A. (2022). A survey of Escherichia coli contamination in eggs of Ardabil and determination of their antibiotic resistance. Veterinary Researches and Biological Products, 34(4): 112-120. (In Persian)
Azizpour, A., Ghazaei, C. (2020). Evaluation of antibiotic resistance pattern of Escherichia coli isolated from broiler chickens with colibacillosis in Ardabil Province, Iran. International Journal of Basic Science in Medicine, 5(4):125- 130.
Bauchart, P., Germon, P., Bree, A., Oswald, E., Hacker, J., Dobrindt, U. (2010). Pathogenomic comparison of human extraintestinal and avian pathogenic Escherichia coli--search for factors involved in host specificity or zoonotic potential. Microbial Pathogenesis, 49(3): 105-115.
Chuba, P. J., Leon, M. A., Banerjee, A., Palchaudhuri, S. (1989). Cloning and DNA sequence of plasmid determinant iss, coding for increased serum survival and surface exclusion, which has homology with lambda DNA. Molecular and General Genetics, 216: 287–292.
Cortés, P., Blanc, V., Mora, A., Dahbi, G., Blanco, J. E., Blanco, M. (2010). Isolation and characterization of potentially pathogenic antimicrobial-resistant Escherichia coli strains from chicken and pig farms in Spain. Applied and Environmental Microbiology, 76(9):2799-2805.
Dissanayake, D. R., Wijewardana, T. G., Gunawardena, G. A., Poxton, I. R. (2008). Distribution of lipopolysaccharide core types among avian pathogenic Escherichia coli in relation to the major phylogenetic groups. Veterinary Microbiology, 132: 355-363.
Ghanbarpour, R., Salehi, M., Oswald, E. (2010). Virulence genotyping of Escherichia coli isolates from avian cellulitis in relation to phylogeny. Comparative Clinical Pathology, 19: 147-153.
Ghorbani, A. R., Khoshbakht, R., Kaboosi, H., Shirzad- Aski, H., Peyravii Ghadikolaii, F. (2021). Phylogenetic relationship and virulence gene profiles of avian pathogenic and uropathogenic Escherichia coli isolated from avian colibacillosis and human urinary tract infections (UTIs). Iranian Journal of Veterinary Research, 22(3): 203-208.
Jantunen, M. E., Siitonen, A., Koskimies, O., Wikstrom, S., Karkkainen, U., Salo, E., Saxen, H. (2000). Predominance of class II papG allele of Escherichia coli in pyelonephritis in infants with normal urinary tract anatomy. Journal of Infectious Diseases, 181: 1822–1824.
Jeffrey, J., Nolan, L., Tonooka, K., Wolfe, S., Giddings, C., Horne, S. (2002). Virulence factors of Escherichia coli from cellulitis or colisepticemia lesions in chickens. Avian diseases, 46(1):48-52.
Johnson, T. J., Wannemuehler, Y., Doetkott, C., Johnson, S. J., Rosenberger, S. C., Nolan, L. K. (2008). Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. Journal of Clinical Microbiology, 46: 3987- 3996.
Johnson, T. J., Wannemuehler, Y. M., Nolan, L. K. (2008). Evolution of the iss gene in Escherichia coli. Applied and Environmental Microbiology, 74(8):2360-9.
Kafshdouzan, Kh., Zahraei-Salehi, T., Nayeri, B., Madadgar, O., Yamasaki, S., Hinenoya, A., Yasuda, N. (2013). Distribution of virulence associated genes in isolated Escherichia coli from avian colibacillosis. Iranian Journal of Veterinary Medicine, 7(1): 1-6.
Kwon, S. G., Cha, S. Y., Choi, E. J., Kim, B., Song, H. J., Jang, H. K. (2008). Epidemiological prevalence of avian pathogenic Escherichia coli differentiated by multiplex PCR from commercial chickens and hatchery in Korea. Journal of Bacteriology and Virology, 38(4): 179-188.
Mellata, M. (2013). Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathogens and Diseases, 10:916–932.
Mokady, D., Gophna, U., Ron, E. Z. (2005). Extensive gene diversity in septicemic Escherichia coli strains. Journal of Clinical Microbiology, 43(1): 66-73.
Monroy, M. A., Kno¨bl, T., Bottino, J. A., Ferreira, C. S., Ferreira, A. J. (2005) Virulence characteristics of Escherichia coli isolates obtained from broiler breeders with salpingitis. Comparative Immunology, Microbiology and Infectious Diseases, 28: 1-15.
Moulin-Schouleur, M., Schouler, C., Tailliez, P., Kao, M. R, Brée, A., Germon, P., Oswald, E., Mainil, J., Blanco, M., Blanco, J. (2006). Common virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. Journal of Clinical Microbiology, 44(10): 3484-3492.
Najafi, S., Rahimi, M., Nikousefat, Z. (2019). Extra-intestinal pathogenic Escherichia coli from human and avian origin: Detection of the most common virulence-encoding genes. Veterinary Research Forum, 10(1): 43-49.
Nakazato, G., de Campos, T. A., Stehling, E. G., Brocchi, M., da Silveira, W. D. (2009). Virulence factors of avian pathogenic Escherichia coli (APEC). Pesquisa Veterinaria Brasileira, 29(7): 479-486.
Nateghi, F., Jafarpour, M., Nazemi, A. (2010). A survey for detection of eight correlated genes of avian pathogenic Escherichia coli in human uropathogenic Escherichia coli. Journal of Microbial World, 3(3): 169-176. (In Persian)
Okuno, K., Yabuta, M., Ooi, T., Kinoshita, S. (2004). Utilization of Escherichia coli outer-membrane endoprotease ompT variants as processing enzymes for production of peptides from designer fusion proteins. Applied and Environmental Microbiology, 70: 76-86.
Rodriguez-Siek, K. E., Giddings, C. W., Doetkott, C., Johnson, T. J., Fakhr, M. K., Nolan, L. K. (2005). Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiology, 151:2097– 2110.
Russo, T. A., Johnson, J. R. (2003). Medical and economic impact of extraintestinal infections due to Escherichia coli: focus on an increasingly important endemic problem. Microbes and Infection, 5:449-456.
Sunwoo, H. H, Wang, W. W, Sim, J. S. (2006). Detection of Escherichia coli O157: H7 using chicken immunoglobulin Y. Immunology letters, 106(2):191-3.
Zhao, L., Gao, S., Huan, H., Xu, X., Zhu, X., Yang, W., Gao, Q., Liu, X. (2009). Comparison of virulence factors and expression of specific genes between uropathogenic Escherichia coli and avian pathogenic E. coli in a murine urinary tract infection model and a chicken challenge model. Microbiology, 155(Pt 5): 1634-1644.
: H7 using chicken immunoglobulin Y. Immunology letters, 106(2):191-3.
Zhao, L., Gao, S., Huan, H., Xu, X., Zhu, X., Yang, W., Gao, Q., Liu, X. (2009). Comparison of virulence factors and expression of specific genes between uropathogenic Escherichia coli and avian pathogenic E. coli in a murine urinary tract infection model and a chicken challenge model. Microbiology, 155(Pt 5): 1634-1644.
Nipane, S. (2012). Effect of Spirulina supplementation on growth performance of broilers. Indian Journal of Veterinary Research (The), 21(1), 66-69.
Mirzaie, S., Zirak-Khattab, F., Hosseini, S. A., & Donyaei-Darian, H. (2018). Effects of dietary Spirulina on antioxidant status, lipid profile, immune response and performance characteristics of broiler chickens reared under high ambient temperature. Asian-Australasian journal of animal sciences, 31(4), 556.
Mohammad Shirazi, R. H. S., Tala, M., Anvar, S. A. A., Nowruzi, B., Saeidi, Z., & Negahban, M. (2021). Investigating Nitrate and Nitrite Concentrations in Drinking Water of Five Districts in Tehran and Assessing the Presence of Nitrate Reducing Bacteria. Journal of Chemical Health Risks, 11(3).
Nowruzi, B. (2024). Industrial application of Natural Phycocyanin Edible Pigment isolated from Spirulina platensis in Preparation of fortified ice cream with emphasize on microbial and antioxident properties. Journal of food science and technology (Iran), 21(149), 54-80.
Nowruzi, B., & Bagheri, F. (2023). An Overview of the Probiotics, Prebiotics, and Metabiotics Functions of Microalgae. Journal of Biosafety, 16(3), 99-124.
Nowruzi, B., & Beiranvand, H. (2024a). A review of medical applications of cyanobacteria. Journal of Isfahan Medical School, 42(755), 69-83.
Nowruzi, B., & Beiranvand, H. (2024b). A review of medical applications of cyanobacteria. Journal of Isfahan Medical School.
Nowruzi, B., Jafari, M., Babaie, S., Motamedi, A., & Anvar, A. (2020). Spirulina: A healthy green sun with bioactive properties. Journal of Microbial World, 13(4), 322-348.
Qureshi, M., Kidd, M., & Ali, R. (1996). Spirulina platensis extract enhances chicken macrophage functions after in vitro exposure. Journal of Nutritional Immunology, 3(4), 35-45.
Satyaraj, E., Reynolds, A., Engler, R., Labuda, J., & Sun, P. (2021). Supplementation of diets with spirulina influences immune and gut function in dogs. Frontiers in Nutrition, 8, 667072.
Selim, S., Hussein, E., & Abou-Elkhair, R. (2018). Effect of Spirulina platensis as a feed additive on laying performance, egg quality and hepatoprotective activity of laying hens. European Poultry Science, 82, 1-13.
Seyidoglu, N., Inan, S., & Aydin, C. (2017). A prominent superfood: Spirulina platensis. Superfood and functional food the development of superfoods and their roles as medicine, 22, 1-27.
Shafaei Bajestani, M., Anvar, S. A. A., Nowruzi, B., & Golestan, L. (2000). Production of Cheese and Ice Cream Enriched With Biomass and Supernatant of Spirulina platensis With Emphasis on Organoleptic and Nutritional Properties. Iranian Journal of Veterinary Medicine, 18(2), 263-278.
Shanmugapriya, B., Babu, S. S., Hariharan, T., Sivaneswaran, S., & Anusha, M. (2015). Dietary administration of Spirulina platensis as probiotics on growth performance and histopathology in broiler chicks. Int. J. Recent Sci. Res, 6(2), 2650-2653.
Sugiharto, S., Yudiarti, T., Isroli, I., & Widiastuti, E. (2018). Effect of feeding duration of Spirulina platensis on growth performance, haematological parameters, intestinal microbial population and carcass traits of broiler chicks. South African Journal of Animal Science, 48(1), 98-107.
Valikboni, S. Q., Anvar, S. A. A., & Nowruzi, B. (2024). Study of the effect of phycocyanin powder on physicochemical characteristics of probiotic acidified feta-type cheese during refrigerated storage. Nutrire, 49(2), 41.
نشریه میکروبیولوژی دامپزشکی دوره نوزدهم، شماره دوم،پاییز و زمستان 1402، پیاپی 47: 112-99 |
مقاله پژوهشی
فراوانی ژنهای omp T، iss وpap GII در اشریشیاکلیهای جدا شده از موارد کلیباسیلوز طیور در شهر تبریز
فرناز جعفری1، سامان مهدوی2*
1- کارشناسی ارشد، گروه میکروبیولوژی، واحد مراغه، دانشگاه آزاد اسلامی، مراغه، ایران
2- دانشیار، گروه میکروبیولوژی، واحد مراغه، دانشگاه آزاد اسلامی، مراغه، ایران
تاریخ دریافت:28/05/1402 تاریخ پذیرش:21/03/1404
چکیده
کلیباسیلوز یکی از بیماریهای بسیار شایع در صنعت پرورش طیور میباشد که سالیانه موجب بروز خسارات اقتصادی زیادی میگردد. هدف از انجام این تحقیق، بررسی فراوانی ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور در شهر تبریز بود. 100 نمونه باکتری اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور (در سال 1400) با روشهای بیوشیمیایی و رنگآمیزی بصورت فنوتیپی تعیین هویت شدند. سپس فراوانی ژنهای iss، omp T و pap GII در این جدایهها به روش Multiplex PCR مورد بررسی قرار گرفت. نتایج نشان داد که فراوانی ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی مورد آزمایش بترتیب 33 درصد، 14 درصد و 22 درصد بود. همچنین یک درصد از جدایههای مورد آزمایش حاوی هر سه ژن مذکور بودند. 23 نمونه منفی از نظر حضور ژنهای مورد مطالعه مشاهده شد. با توجه به حضور ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی جدا شده از طیور میتوان نتیجهگیری کرد که این ژنها میتوانند به عنوان عوامل موثر در عفونتهای خارج رودهای باکتری مطرح باشند. همچنین ژن iss به دلیل دارا بودن بیشترین میزان فراوانی در بین ژنهای مورد مطالعه، با احتمال بیشتری میتواند بطور بالقوه به عنوان مهمترین عامل بیماریزایی در اشریشیاکلیهای جدا شده از طیور معرفی شود.
کلمات کلیدی: اشریشیاکلی، کلیباسیلوز طیور، ژنهای حدت
* نویسنده مسئول سامان مهدوی
آدرس: گروه میکروبیولوژی، واحد مراغه، دانشگاه آزاد اسلامی، مراغه، ایران
پست الکترونیک: S.Mahdavi@iau-maragheh.ac.ir
مقدمه
اشریشیاکلی بیماریزای پرندگان APEC (Avian Pathogenic Eschrichia coli) زیر مجموعهای از گروه بزرگ باکتریهایی است که اشریشیاکلی بیماریزای خارج رودهایExPEC (Extraintestinal pathogenic Escherichia coli) نامیده میشود (Ghanbarpour et al., 2010). اشریشیاکلی بیماریزای خارج رودهای (ExPEC) عامل ایجاد کننده کلیباسیلوز در طیور و نیز عفونتهای مختلف در انسان میباشند که از این جمله میتوان به عفونتهای دستگاه ادراری، مننژیت نوزادان و سپسیس اشاره کرد (Mellata, 2013). جدایههای بیماریزای پرندگان، بیماریهای مختلفی در طیور ایجاد میکنند. کلیباسیلوز رایجترین عفونت باکتریایی در گلههای طیور میباشد که خسارتهای اقتصادی زیادی ایجاد میکند (Azizpour and Ghazaei, 2020; Russo and Johnson., 2003 ). اشریشیاکلیهای بیماریزای پرندگان نقش مهمی به عنوان پاتوژن منتقله از راه خوراک بر عهده دارند و فراوردههای طیور، منبع مناسبی از ExPEC از جمله جدایههای بیماریزا در انسان میباشند (Johnson et al., 2008). سویههای بیماریزای این باکتری جزء میکروفلور طبیعی دستگاه گوارش بوده و در شرایط استرس محیطی و تضعیف سیستم ایمنی باعث ایجاد بیماری کلیباسیلوز میشوند. حدود 15-10 درصد از کلیفرمهای روده مربوط به سروتیپهای بیماریزا هستند (Akond et al., 2015; Dissanayake et al., 2008). تحقیقات نشان داده است که سویههای APEC و ExPEC مخزن ژنی مشابهی در خصوص ژنهای حدت دارند. بنابراین فرضیاتی مانند زئونوز بودن سویههای APEC و ExPEC و نیز معرفی سویه APEC یه عنوان مخزنی برای ژنهای وابسته به حدت ExPEC در انسان میتواند قابل توجه باشد (Bauchart et al., 2010; Jeffrey et al., 2002 ). ژنهای مرتبط با بیماریزایی شایع بین APEC و UPEC شامل ژن افزایش بقای سرمی (iss)، ژنهای پیلی مرتبط با پیلونفریت (pap GII) و پروتئین غشای بیرونی T (omp T) هستند که ویژگیهای مشترک خود را نشان میدهند (Zhao et al., 2009). شایعترین ژنهای اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور در ایران عبارتند از: hly F، omp T، iss، iut A و pap GII (Kafshdouzan et al., 2013). عامل اصلی در پاتوژنز باکتری اشریشیاکلی، توانایی این باکتری برای چسبیدن به بافت میزبان و کلونیزه شدن درآن است (Monroy et al., 2005). در فیمبریه، فيمبرين pap G در نوك رشته انتهاي فيمبريه قرار گرفته و امكان اتصال باكتري به پذيرندههاي اختصاصي ميزبان را فراهم ميسازد و به همين دليل آن را تحت واحد چسبندگی (Adhesin) مینامند (Cortés et al., 2010). ژن pap GII شایعترین عامل اتیولوژیک عفونت مجاری ادراری میباشد که مهمترین عامل حدت آن، فیمبریهp است. اشریشیاکلی یوروپاتوژن، انواع مختلفی از Adhesin مانند آدزینهای پیلی papرا بیان میکند که واسطه اتصال به سطح سلولهای اپیتلیال مجاری ادراری هستند (Jantunen et al., 2000; Sunwoo et al., 2006). ژن iss به عنوان معمولترین ژن کدکننده APEC، شایعترین عامل حدت در جدایههای اشریشیاکلی میباشد (Najafi et al., 2019). به علت این که شکل بروز کلیباسیلوز طیور اکثراً سپتیسمی است و این عامل حدت، نقش مهمی در پاتوژنز این بیماری دارد (Zhao et al., 2009) مقاومت سرمی در بسیاری از انواع میکروارگانسیمهای پاتوژن مهم است و یکی از با ارزشترین فاکتورهای حدت باکتریایی جهت مطالعه به ویژه در بیماری کلیباسیلوز طیور محسوب میشود (Johnson et al., 2008). ژن iss بیان کننده پروتئین ISS است که کدکننده پروتئین آئروباکتین بوده و باعث افزایش پایداری اشریشیاکلی و مقاومت سرمی این باکتری در برابر سیستم کمپلمان میزبان میشود. ژن omp T سبب بیان omp T میشود که پروتئازی است که غیرفعالسازی کلیسین را بر عهده دارد (Sunwoo et al., 2006). اگرچه عملکرد فیزیولوژیکی omp T نامشخص است، ولی در پاتوژنز اشریشیاکلی نقش دارد و میتواند پپتیدهای ضدمیکروبی را غیرفعال کند (Okuno et al., 2004). با توجه به اهمیت ژنهای ذکر شده و نقش آنها در حدت باکتری اشریشیاکلی، مطالعه اخیر با هدف بررسی فراوانی ژنهای omp T، iss وpap GII در اشریشیاکلیهای جدا شده از موارد کلیباسیلوز طیور در شهر تبریز انجام شد.
مواد و روشها
جمعآوری و جداسازی نمونهها
در این تحقیق، 100 نمونه اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور (از 15 مزرعه پرورش طیور گوشتی) بین ماههای فروردین تا آبان 1400 در شهر تبریز برای کار تحقیقی اخیر در نظر گرفته شد. بعد از کالبدگشائی طیور مبتلا و مشاهده علایم کلیسپتیسمی، در شرایط استریل، با سوآپ از ترشحات سطح بافت و با ایجاد شکاف با لوپ، قسمتی از بافت کبد و قلب در محیط مکانکی آگار کشت داده شد. پس از 72-24 ساعت گرمخانهگذاری در دمای 37 درجه سانتیگراد، پرگنههای صاف لاکتوز مثبت انتخاب شده و پس از رنگ آمیزی باکتریها به روش گرم، آزمایشات تکمیلی بیوشیمیایی جهت تایید تشخیص فنوتیپی باکتریهای اشریشیاکلی صورت گرفت که شامل موارد زیر بود: SIM، سیمون سیترات آگار، متیل ردMR (Methyl red)، وژ پروسکائر VP (Voges Proskauer)، TSI (Triple Sugar Iron agar) و اوره آگار (شرکت مرک، کشور آلمان) (Azizpour, 2022; Rodriguez-Siek et al., 2005 ).
استخراج DNA
استخراج DNA ژنومی به روش جوشاندن انجام شد. استخراج DNA روی 100 ایزوله کشت شده اشریشیاکلی در محیط کشت قلب مغز (BHI) آگار (شرکت مرک، کشور آلمان) در دمای 35 درجه سلسیوس به مدت 24 ساعت انجام شد. 5-3 کلنی از هر نمونه در لوله 5/1 میلی لیتری اپندورف حاوی 200 میکرولیتر بافر TE استریل ریخته شد و با استفاده از شیکر کاملاً مخلوط شد. سپس ویالها به مدت 10 دقیقه در دمای 100 درجه سلسیوس جوشانده شد، به طوری که سطح آب جوش، دو سوم ویالها را پوشش داد. در نهایت، ویالها با دورg 9000 به مدت 10-5 دقیقه سانتریفیوژ شدند. مایع رویی ویالهای حاوی DNA برای آزمایش PCR به اپندورف استریل منتقل شد (Ahmadi et al., 2019). بررسی کمیت و کیفیت DNA استخراج شده توسط دستگاههای نانودراپ و الکتروفورز بر روی آگارز 5/1 درصد انجام شد.
شناسایی مولکولی ژنهای مورد مطالعه
به منظور بررسی فراوانی ژنهای مورد مطالعه از روش Multiplex PCR استفاده شد. مشخصات و توالی پرایمرهای مورد استفاده در جدول 1 نشان داده شده است. واکنش زنجیرهای پلیمراز (PCR) در حجم 25 میکرولیتر شامل 8 میکرولیتر آب دیونیزه استریل، 5/2 میکرولیتر بافرPCR (10X)، 4 میکرولیتر MgCl2(mM50)، 3 میکرولیتر dNTPs(mM25)، 5/1 میکرولیتر پرایمر رفت، 5/1 میکرولیتر پرایمر برگشت، 5/3 میکرولیتر DNA پلیمراز Taq و 1 میکرولیتر DNA الگو انجام شد.
جدول 1- توالی و ویژگی پرایمرهای اختصاصی مورد استفاده جهت شناسایی ژنهای مورد مطالعه در نمونههای اشریشیاکلی
ژن | توالی (3′→5′) | اندازه محصول (bp) | منبع |
Omp T | F: ATCTAGCCGAAGAAGGAGGC R: CCCGGGTCATAGTGTTCATC | 559 | Zhao et al., 2009 |
iss | F: CAGCAACCCGAACCACTTGATG R: AGCATTGCCAGAGCGGCAGAA | 323 | Zhao et al., 2009 |
Pap GII | F: GGGATGAGCGGGCCTTTGAT R: CGGGCCCCCAAGTAACTCG | 190 | Zhao et al., 2009 |
واکنش PCR با شرایط دمایی 4 دقیقه واسرشت شدن ابتدایی در دمای 94 درجه سانتیگراد و در ادامه 30 چرخه شامل واسرشت شدن در دمای 94 درجه سانتیگراد به مدت 30 ثانیه، اتصال در دمای 58 درجه سانتیگراد به مدت 30 ثانیه و طویل شدن در دمای 72 درجه سانتیگراد به مدت 90 ثانیه و در نهایت طویل شدن انتهایی در دمای 72 درجه سانتیگراد به مدت 5 دقیقه انجام شد. محصول PCR به مدت 1 ساعت بر روی ژل آگارز 5/1 درصد رنگ آمیزی شده با اتیدیوم بروماید الکتروفورز شد. از باکتری اشریشیاکلی ATCC 10536 به عنوان کنترل مثبت و از آب دوبار تقطیر استریل، به عنوان کنترل منفی استفاده شد.
نتایج
نتایج نشان داد که از 100 نمونه باکتری اشریشیاکلی مورد مطالعه، 33 نمونه (33 درصد) دارای ژن iss، 22 نمونه (22 درصد) حاوی ژن pap GII و 14 نمونه (14 درصد) دارای ژن omp T بودند (شکل 1). تنها یک نمونه (1 درصد) از جدایههای اشریشیاکلی مورد آزمایش حاوی هر سه ژن مورد مطالعه بودند. 23 جدایه اشریشیاکلی فاقد هر یک از ژنهای حدت مورد آزمایش بودند (جدول 2).
بحث
اشریشیاکلی بیماریزای پرندگان (APEC) یکی از مهمترین عوامل عفونی در پرورش طیور گوشتی و نیز عامل اصلی کلیباسیلوز در پرندگان میباشد (Azizpour and Ghazaei, 2020).
شکل 1- نتایج حاصل از الکتروفورز محصول PCR Multiplex جدایههای اشریشیاکلی مورد مطالعه. شماره 1: مارکر (bp100)، شماره 2: کنترل منفی، شماره 8: کنترل مثبت، شمارههای 3، 10، 11 و 14: نشاندهنده حضور ژنهای مورد آزمایش.
جدول2- فراوانی ژنهای مورد مطالعه و فراوانی با هم بودن این ژنها در یک جدایه
ژن | تعداد جدایهها | الگوی حضور ژن حدت | تعداد جدایهها |
iss | 33 | iss + omp T | 1 |
Omp T | 14 | iss + papG II | 2 |
Pap GII | 22 | Omp T + pap GII | 4 |
فاقد ژن حدت | 23 | iss +omp T + pap GII | 1 |
جمع | 100 |
|
|
این پاتوتیپ باکتریایی به دنبال عفونتهای اولیه ویروسی و مایکوپلاسمایی، به صورت ثانویه بروز کرده و موجب کلیسپتیسمی شده و میتواند خسارات اقتصادی فراوانی را به صنعت طیور وارد سازد (Kwon et al., 2008; Nakazato et al., 2009). شواهدی وجود دارد که نشان میدهد سویههای APEC نقش مهمی را بهعنوان یک پاتوژن غذازاد بازی میکنند و محصولات طیور میتوانند منبع مجموعهای از EXPEC از جمله سویههای عامل بیماریهای انسانی باشند. بنابراین، کنترل کلیباسیلوز مشکل جدی در آینده خواهد بود که برای سلامت انسان و حیوانات مفید است (Johnson et al., 2008). برخی از مطالعات، مشاهداتی مبنی بر انطباقپذیری سویههای APEC در میزبان انسانی و همچنین انتقال پلاسمیدهای آنها ارائه نموده است. از طرفی، مطالعات دیگری نیز تشابهات فیلوژنتیکی، ژنوتیپی و سروتیپی را در بین سویههای APEC و ExPEC انسانی مشتق شده از عفونتهای دستگاه ادراری و مننژیت نوزادان نشان داده است (Mokady et al., 2005; Moulin-Schouleur et al., 2006 ). نتایج تحقیق اخیر نشان داد که فراوانی ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور در شهر تبریز بترتیب 33 درصد، 14 درصد و 22 درصد بود. همچنین تنها یک جدایه مورد آزمایش، بطور همزمان دارای هر سه ژن مذکور بود. این مطالعه برای اولین بار بر روی فراوانی ژنهای مذکور در باکتریهای اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور در شهر تبریز انجام شده است. ناطقی و همکاران (2010) گزارش کردند که فراوانی ژن iss در باکتریهای اشریشیاکلی جدا شده از بیماران مبتلا به عفونتهای ادراری انسان و جوجههای گوشتی مبتلا به کلیباسیلوز بترتیب 11 درصد و 43/96 درصد بود (Nateghi et al., 2010). قربانی و همکاران (2021) گزارش کردند که فراوانی ژن iss در باکتریهای اشریشیاکلی جدا شده از موارد عفونتهای مجرای ادراری در انسان و موارد جدا شده از کلیباسیلوز طیور بترتیب 7/5 درصد و 4/11 درصد بود (Ghorbani et al., 2021). کفشدوزان و همکاران (2013) گزارش کردند که فراوانی ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی جدا شده از کلیباسیلوز طیور بترتیب 2/68 درصد، 73 درصد و 6/17 درصد بود (Kafshdouzan et al., 2013). قنبرپور و همکاران (2010) نشان دادند که 06/14 درصد از باکتریهای اشریشیاکلی جدا شده از موارد سلولیت طیور در ایران حاوی ژن pap GII بودند (Ghanbarpour et al., 2010). نجفی و همکاران (2019) گزارش کردند که فراوانی ژنهای iss، omp T و pap GII در باکتریهای اشریشیاکلی جدا شده از کلیباسیلوز طیور بترتیب 89 درصد، 63 درصد و 67 درصد بود (Najafi et al., 2019). تفاوت فراوانی ژنهای iss، omp T و pap GII در نمونههای جدا شده از موارد کلیباسیلوز طیور در این مطالعه نسبت به سایر مطالعات نشان دهنده اختلاف در پراکندگی ژنهای حدت مذکور در بین سویههای مختلف اشریشیاکلی میباشد که این امر احتمالا" از تفاوتهای جغرافیایی و نیز اختلاف در منشاء اکولوژیکی سویههای جدا شده (مواد غذایی، انسان و دام) ناشی میشود. از طرف دیگر لازم به ذکر است که حضور ژنهای حدت مورد مطالعه در این تحقیق به معنی بیان ژنهای مذکور و بیماریزایی بیشتر این جدایهها نیست. ضروری است مطالعات بیشتری در این زمینه انجام گیرد تا اهمیت بالینی این شاخصههای حدت را در میزبانها ارزیابی نماید و مشخص نمایند که طیور به عنوان منبع ژنهای حدت در جوامع انسانی و بالعکس مطرح میباشند.
نتیجهگیری
در این تحقیق، فراوانی ژن iss نسبت به ژنهای omp T و pap GII در نمونههای اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور بیشتر بود که با نتایج اکثر مطالعات همخوانی دارد و با احتمال بیشتری میتواند به عنوان مهمترین عامل بیماریزایی در باکتریهای اشریشیاکلی جدا شده از موارد کلیباسیلوز طیور معرفی شود. همچنین حضور ژنهای حدت مورد مطالعه در باکتریهای اشریشیاکلی جدا شده از طیور به ویژه ژن iss، میتواند به عنوان عامل موثر در حضور خارج رودهای این جدایهها مطرح باشد.
سپاسگزاری
از کلیه کسانی که در انجام این تحقیق، همکاری و مساعدت داشتند کمال تشکر و قدردانی را داریم.
منابع
2. Abed, S., Nowruzi, B., & Anvar, S. A. A. (2025). Production of Oncorhynchus mykiss biosensor based on polyvinyl alcohol/chitosan nanocomposite using phycocyanin during refrigerated storage. Scientific reports, 15(1), 703.
3. Abouelezz, F. (2017). Evaluation of spirulina algae (Spirulina platensis) as a feed supplement for japanese quail: nutiritional effects on growth performance, egg production, egg quality, blood metabolites, sperm-egg penetration and fertility. Egyptian Poultry Science Journal, 37(3), 707-719.
4. Ahmadi, A., Anvar, S. A. A., Nowruzi, B., & Golestan, L. (2024). Effect of phycocyanin and phycoerythrin on antioxidant and antimicrobial activity of refrigerated low-fat yogurt and cream cheese. Scientific reports, 14(1), 27661.
5. Al-Batshan, H. A., Al-Mufarrej, S. I., Al-Homaidan, A. A., & Qureshi, M. (2001). Enhancement of chicken macrophage phagocytic function and nitrite production by dietary Spirulina platensis. Immunopharmacology and immunotoxicology, 23(2), 281-289.
6. Al-Khalaifah, H. S., Al-Nasser, A., & Surrayai, T. (2022). Effects from dietary addition of sargassum sp., spirulina sp., or gracilaria sp. powder on immune status in broiler chickens. Frontiers in Veterinary Science, 9, 928235.
7. Alaqil, A. A., & Abbas, A. O. (2023). The effects of dietary Spirulina platensisis on physiological responses of broiler chickens exposed to endotoxin stress. Animals, 13(3), 363.
8. Alibabai, M., Khajeh-Rahimi, A.-E., & Nowruzi, B. (2023). A review of recent developments in the use of cyanobacteria and microalgae in improving the quality and increasing the shelf life of seafood products.
9. Alwaleed, E. A., El-Sheekh, M., Abdel-Daim, M. M., & Saber, H. (2021). Effects of Spirulina platensis and Amphora coffeaeformis as dietary supplements on blood biochemical parameters, intestinal microbial population, and productive performance in broiler chickens. Environmental Science and Pollution Research, 28, 1801-1811.
10. Anvar, A., & Nowruzi, B. (2021). Bioactive properties of spirulina: A review. Microb. Bioact, 4, 134-142.
11. Anvar, S., & Nowruzi, B. (2022). A review of microalgae as dietary and medicinal useful complements.
12. Anvar, S. A. A., Nowruzi, B., & Afshari, G. (2023). A review of the application of nanoparticles biosynthesized by microalgae and cyanobacteria in medical and veterinary sciences.
13. Behjati, M., Ataee, M., Nowruzi, B., Anvar, S. A. A., & Ahari, H. (2025). STUDYING THE ANTIOXIDANT AND ANTIMICROBIAL ACTIVITY OF PHYCOERYTHRIN TO INCREASE THE SHELF LIFE OF HAMBURGERS AT REFRIGERATOR TEMPERATURE. Journal of microbiology, biotechnology and food sciences, 14(5), e11625-e11625.
14. Bonos, E., Kasapidou, E., Kargopoulos, A., Karampampas, A., Nikolakakis, I., Christaki, E., & Florou-Paneri, P. (2016). Spirulina as a functional ingredient in broiler chicken diets. South African Journal of Animal Science, 46(1), 94-102.
15. Bortolini, D. G., Maciel, G. M., Fernandes, I. d. A. A., Pedro, A. C., Rubio, F. T. V., Branco, I. G., & Haminiuk, C. W. I. (2022). Functional properties of bioactive compounds from Spirulina spp.: Current status and future trends. Food Chemistry: Molecular Sciences, 5, 100134.
16. Chamari, M., Anvar, S. A. A., Pourahmad, R., Nowruzi, B., & Yousefi, S. (2024). Study of alginate-encapsulated phycoerythrin in promoting the biological activity of synbiotic ice cream with Lactobacillus casei. Scientific reports, 14(1), 15471.
17. Chen, Y.-Y., Chen, J.-C., Tayag, C. M., Li, H.-F., Putra, D. F., Kuo, Y.-H., . . . Chang, Y.-H. (2016). Spirulina elicits the activation of innate immunity and increases resistance against Vibrio alginolyticus in shrimp. Fish & shellfish immunology, 55, 690-698.
18. El-Shall, N. A., Jiang, S., Farag, M. R., Azzam, M., Al-Abdullatif, A. A., Alhotan, R., . . . Alagawany, M. (2023). Potential of Spirulina platensis as a feed supplement for poultry to enhance growth performance and immune modulation. Frontiers in Immunology, 14, 1072787.
19. Elbaz, A. M., Ahmed, A. M., Abdel-Maqsoud, A., Badran, A. M., & Abdel-Moneim, A.-M. E. (2022). Potential ameliorative role of Spirulina platensis in powdered or extract forms against cyclic heat stress in broiler chickens. Environmental Science and Pollution Research, 29(30), 45578-45588.
20. Fathi, M. A. (2018). Effect of dietary supplementation of algae meal (Spirulina platensis) as growth promoter on performance of broiler chickens. Egyptian Poultry Science Journal, 38(2), 375-389.
21. Hajati, H., & Zaghari, M. (2019). Effects of Spirulina platensis on growth performance, carcass characteristics, egg traits and immunity response of Japanese quails. Iranian Journal of Applied Animal Science, 9(2), 347-357.
22. Holman, B., & Malau‐Aduli, A. (2013). Spirulina as a livestock supplement and animal feed. Journal of animal physiology and animal nutrition, 97(4), 615-623.
23. Iry, N., Nowruzi, B., & Ghazi, S. (2023). Study of the effect of phycocyanin pigment on physicochemical, sensory, microbial and antioxidant properties of cheese. Research and Innovation in Food Science and Technology, 12(1), 55-76.
24. Jamil, A. R., Akanda, M. R., Rahman, M. M., Hossain, M. A., & Islam, M. S. (2015). Prebiotic competence of Spirulina on the production performance of broiler chickens.
25. Kaoud, H. A. (2015). Effect of Spirulina platensis as a dietary supplement on broiler performance in comparison with prebiotics. specialty journal of biological sciences, 1(2-2015), 1-6.
26. Kashi, M. S., Ghazi, S., & Nowruzi, B. (2024). Industrial application of Natural Phycocyanin Edible Pigment isolated from Spirulina platensis in Preparation of fortified ice cream with emphasize on microbial and antioxident properties. Iranian journal of food science and industry, 21(149).
27. Khan, S., Mobashar, M., Mahsood, F. K., Javaid, S., Abdel-Wareth, A., Ammanullah, H., & Mahmood, A. (2020). Spirulina inclusion levels in a broiler ration: evaluation of growth performance, gut integrity, and immunity. Tropical Animal Health and Production, 52, 3233-3240.
28. Kharde, S., Shirbhate, R., Bahiram, K., & Ahmadi, M., Dadashzadeh, S., Ghaniei, A. (2019). Prevalence of virulence genes in Escherichia coli isolates implicated in poultry colibacillosis and human urinary tract infection. Journal of Veterinary Microbiology, 15(1): 109-118. (In Persian)
29. Akond, M. A., Alam, S., Hassan, S. M. R., Shirin, M. (2015). Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of Bangladesh. Internet Journal of Food Safety, 11: 19-23ce.
30. Azizpour, A. (2022). A survey of Escherichia coli contamination in eggs of Ardabil and determination of their antibiotic resistance. Veterinary Researches and Biological Products, 34(4): 112-120. (In Persian)
31. Azizpour, A., Ghazaei, C. (2020). Evaluation of antibiotic resistance pattern of Escherichia coli isolated from broiler chickens with colibacillosis in Ardabil Province, Iran. International Journal of Basic Science in Medicine, 5(4):125- 130.
32. Bauchart, P., Germon, P., Bree, A., Oswald, E., Hacker, J., Dobrindt, U. (2010). Pathogenomic comparison of human extraintestinal and avian pathogenic Escherichia coli--search for factors involved in host specificity or zoonotic potential. Microbial Pathogenesis, 49(3): 105-115.
33. Chuba, P. J., Leon, M. A., Banerjee, A., Palchaudhuri, S. (1989). Cloning and DNA sequence of plasmid determinant iss, coding for increased serum survival and surface exclusion, which has homology with lambda DNA. Molecular and General Genetics, 216: 287–292.
34. Cortés, P., Blanc, V., Mora, A., Dahbi, G., Blanco, J. E., Blanco, M. (2010). Isolation and characterization of potentially pathogenic antimicrobial-resistant Escherichia coli strains from chicken and pig farms in Spain. Applied and Environmental Microbiology, 76(9):2799-2805.
35. Dissanayake, D. R., Wijewardana, T. G., Gunawardena, G. A., Poxton, I. R. (2008). Distribution of lipopolysaccharide core types among avian pathogenic Escherichia coli in relation to the major phylogenetic groups. Veterinary Microbiology, 132: 355-363.
36. Ghanbarpour, R., Salehi, M., Oswald, E. (2010). Virulence genotyping of Escherichia coli isolates from avian cellulitis in relation to phylogeny. Comparative Clinical Pathology, 19: 147-153.
37. Ghorbani, A. R., Khoshbakht, R., Kaboosi, H., Shirzad- Aski, H., Peyravii Ghadikolaii, F. (2021). Phylogenetic relationship and virulence gene profiles of avian pathogenic and uropathogenic Escherichia coli isolated from avian colibacillosis and human urinary tract infections (UTIs). Iranian Journal of Veterinary Research, 22(3): 203-208.
38. Jantunen, M. E., Siitonen, A., Koskimies, O., Wikstrom, S., Karkkainen, U., Salo, E., Saxen, H. (2000). Predominance of class II papG allele of Escherichia coli in pyelonephritis in infants with normal urinary tract anatomy. Journal of Infectious Diseases, 181: 1822–1824.
39. Jeffrey, J., Nolan, L., Tonooka, K., Wolfe, S., Giddings, C., Horne, S. (2002). Virulence factors of Escherichia coli from cellulitis or colisepticemia lesions in chickens. Avian diseases, 46(1):48-52.
40. Johnson, T. J., Wannemuehler, Y., Doetkott, C., Johnson, S. J., Rosenberger, S. C., Nolan, L. K. (2008). Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. Journal of Clinical Microbiology, 46: 3987- 3996.
41. Johnson, T. J., Wannemuehler, Y. M., Nolan, L. K. (2008). Evolution of the iss gene in Escherichia coli. Applied and Environmental Microbiology, 74(8):2360-9.
42. Kafshdouzan, Kh., Zahraei-Salehi, T., Nayeri, B., Madadgar, O., Yamasaki, S., Hinenoya, A., Yasuda, N. (2013). Distribution of virulence associated genes in isolated Escherichia coli from avian colibacillosis. Iranian Journal of Veterinary Medicine, 7(1): 1-6.
43. Kwon, S. G., Cha, S. Y., Choi, E. J., Kim, B., Song, H. J., Jang, H. K. (2008). Epidemiological prevalence of avian pathogenic Escherichia coli differentiated by multiplex PCR from commercial chickens and hatchery in Korea. Journal of Bacteriology and Virology, 38(4): 179-188.
44. Mellata, M. (2013). Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathogens and Diseases, 10:916–932.
45. Mokady, D., Gophna, U., Ron, E. Z. (2005). Extensive gene diversity in septicemic Escherichia coli strains. Journal of Clinical Microbiology, 43(1): 66-73.
46. Monroy, M. A., Kno¨bl, T., Bottino, J. A., Ferreira, C. S., Ferreira, A. J. (2005) Virulence characteristics of Escherichia coli isolates obtained from broiler breeders with salpingitis. Comparative Immunology, Microbiology and Infectious Diseases, 28: 1-15.
47. Moulin-Schouleur, M., Schouler, C., Tailliez, P., Kao, M. R, Brée, A., Germon, P., Oswald, E., Mainil, J., Blanco, M., Blanco, J. (2006). Common virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. Journal of Clinical Microbiology, 44(10): 3484-3492.
48. Najafi, S., Rahimi, M., Nikousefat, Z. (2019). Extra-intestinal pathogenic Escherichia coli from human and avian origin: Detection of the most common virulence-encoding genes. Veterinary Research Forum, 10(1): 43-49.
49. Nakazato, G., de Campos, T. A., Stehling, E. G., Brocchi, M., da Silveira, W. D. (2009). Virulence factors of avian pathogenic Escherichia coli (APEC). Pesquisa Veterinaria Brasileira, 29(7): 479-486.
50. Nateghi, F., Jafarpour, M., Nazemi, A. (2010). A survey for detection of eight correlated genes of avian pathogenic Escherichia coli in human uropathogenic Escherichia coli. Journal of Microbial World, 3(3): 169-176. (In Persian)
51. Okuno, K., Yabuta, M., Ooi, T., Kinoshita, S. (2004). Utilization of Escherichia coli outer-membrane endoprotease ompT variants as processing enzymes for production of peptides from designer fusion proteins. Applied and Environmental Microbiology, 70: 76-86.
52. Rodriguez-Siek, K. E., Giddings, C. W., Doetkott, C., Johnson, T. J., Fakhr, M. K., Nolan, L. K. (2005). Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiology, 151:2097– 2110.
53. Russo, T. A., Johnson, J. R. (2003). Medical and economic impact of extraintestinal infections due to Escherichia coli: focus on an increasingly important endemic problem. Microbes and Infection, 5:449-456.
1. Sunwoo, H. H, Wang, W. W, Sim, J. S. (2006). Detection of Escherichia coli O157 Ahmadi, M., Dadashzadeh, S., Ghaniei, A. (2019). Prevalence of virulence genes in Escherichia coli isolates implicated in poultry colibacillosis and human urinary tract infection. Journal of Veterinary Microbiology, 15(1): 109-118. (In Persian)
2. Akond, M. A., Alam, S., Hassan, S. M. R., Shirin, M. (2015). Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of Bangladesh. Internet Journal of Food Safety, 11: 19-23ce.
3. Azizpour, A. (2022). A survey of Escherichia coli contamination in eggs of Ardabil and determination of their antibiotic resistance. Veterinary Researches and Biological Products, 34(4): 112-120. (In Persian)
4. Azizpour, A., Ghazaei, C. (2020). Evaluation of antibiotic resistance pattern of Escherichia coli isolated from broiler chickens with colibacillosis in Ardabil Province, Iran. International Journal of Basic Science in Medicine, 5(4):125- 130.
5. Bauchart, P., Germon, P., Bree, A., Oswald, E., Hacker, J., Dobrindt, U. (2010). Pathogenomic comparison of human extraintestinal and avian pathogenic Escherichia coli--search for factors involved in host specificity or zoonotic potential. Microbial Pathogenesis, 49(3): 105-115.
6. Chuba, P. J., Leon, M. A., Banerjee, A., Palchaudhuri, S. (1989). Cloning and DNA sequence of plasmid determinant iss, coding for increased serum survival and surface exclusion, which has homology with lambda DNA. Molecular and General Genetics, 216: 287–292.
7. Cortés, P., Blanc, V., Mora, A., Dahbi, G., Blanco, J. E., Blanco, M. (2010). Isolation and characterization of potentially pathogenic antimicrobial-resistant Escherichia coli strains from chicken and pig farms in Spain. Applied and Environmental Microbiology, 76(9):2799-2805.
8. Dissanayake, D. R., Wijewardana, T. G., Gunawardena, G. A., Poxton, I. R. (2008). Distribution of lipopolysaccharide core types among avian pathogenic Escherichia coli in relation to the major phylogenetic groups. Veterinary Microbiology, 132: 355-363.
9. Ghanbarpour, R., Salehi, M., Oswald, E. (2010). Virulence genotyping of Escherichia coli isolates from avian cellulitis in relation to phylogeny. Comparative Clinical Pathology, 19: 147-153.
10. Ghorbani, A. R., Khoshbakht, R., Kaboosi, H., Shirzad- Aski, H., Peyravii Ghadikolaii, F. (2021). Phylogenetic relationship and virulence gene profiles of avian pathogenic and uropathogenic Escherichia coli isolated from avian colibacillosis and human urinary tract infections (UTIs). Iranian Journal of Veterinary Research, 22(3): 203-208.
11. Jantunen, M. E., Siitonen, A., Koskimies, O., Wikstrom, S., Karkkainen, U., Salo, E., Saxen, H. (2000). Predominance of class II papG allele of Escherichia coli in pyelonephritis in infants with normal urinary tract anatomy. Journal of Infectious Diseases, 181: 1822–1824.
12. Jeffrey, J., Nolan, L., Tonooka, K., Wolfe, S., Giddings, C., Horne, S. (2002). Virulence factors of Escherichia coli from cellulitis or colisepticemia lesions in chickens. Avian diseases, 46(1):48-52.
13. Johnson, T. J., Wannemuehler, Y., Doetkott, C., Johnson, S. J., Rosenberger, S. C., Nolan, L. K. (2008). Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. Journal of Clinical Microbiology, 46: 3987- 3996.
14. Johnson, T. J., Wannemuehler, Y. M., Nolan, L. K. (2008). Evolution of the iss gene in Escherichia coli. Applied and Environmental Microbiology, 74(8):2360-9.
15. Kafshdouzan, Kh., Zahraei-Salehi, T., Nayeri, B., Madadgar, O., Yamasaki, S., Hinenoya, A., Yasuda, N. (2013). Distribution of virulence associated genes in isolated Escherichia coli from avian colibacillosis. Iranian Journal of Veterinary Medicine, 7(1): 1-6.
16. Kwon, S. G., Cha, S. Y., Choi, E. J., Kim, B., Song, H. J., Jang, H. K. (2008). Epidemiological prevalence of avian pathogenic Escherichia coli differentiated by multiplex PCR from commercial chickens and hatchery in Korea. Journal of Bacteriology and Virology, 38(4): 179-188.
17. Mellata, M. (2013). Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathogens and Diseases, 10:916–932.
18. Mokady, D., Gophna, U., Ron, E. Z. (2005). Extensive gene diversity in septicemic Escherichia coli strains. Journal of Clinical Microbiology, 43(1): 66-73.
19. Monroy, M. A., Kno¨bl, T., Bottino, J. A., Ferreira, C. S., Ferreira, A. J. (2005) Virulence characteristics of Escherichia coli isolates obtained from broiler breeders with salpingitis. Comparative Immunology, Microbiology and Infectious Diseases, 28: 1-15.
20. Moulin-Schouleur, M., Schouler, C., Tailliez, P., Kao, M. R, Brée, A., Germon, P., Oswald, E., Mainil, J., Blanco, M., Blanco, J. (2006). Common virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. Journal of Clinical Microbiology, 44(10): 3484-3492.
21. Najafi, S., Rahimi, M., Nikousefat, Z. (2019). Extra-intestinal pathogenic Escherichia coli from human and avian origin: Detection of the most common virulence-encoding genes. Veterinary Research Forum, 10(1): 43-49.
22. Nakazato, G., de Campos, T. A., Stehling, E. G., Brocchi, M., da Silveira, W. D. (2009). Virulence factors of avian pathogenic Escherichia coli (APEC). Pesquisa Veterinaria Brasileira, 29(7): 479-486.
23. Nateghi, F., Jafarpour, M., Nazemi, A. (2010). A survey for detection of eight correlated genes of avian pathogenic Escherichia coli in human uropathogenic Escherichia coli. Journal of Microbial World, 3(3): 169-176. (In Persian)
24. Okuno, K., Yabuta, M., Ooi, T., Kinoshita, S. (2004). Utilization of Escherichia coli outer-membrane endoprotease ompT variants as processing enzymes for production of peptides from designer fusion proteins. Applied and Environmental Microbiology, 70: 76-86.
25. Rodriguez-Siek, K. E., Giddings, C. W., Doetkott, C., Johnson, T. J., Fakhr, M. K., Nolan, L. K. (2005). Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiology, 151:2097– 2110.
26. Russo, T. A., Johnson, J. R. (2003). Medical and economic impact of extraintestinal infections due to Escherichia coli: focus on an increasingly important endemic problem. Microbes and Infection, 5:449-456.
27. Sunwoo, H. H, Wang, W. W, Sim, J. S. (2006). Detection of Escherichia coli O157: H7 using chicken immunoglobulin Y. Immunology letters, 106(2):191-3.
28. Zhao, L., Gao, S., Huan, H., Xu, X., Zhu, X., Yang, W., Gao, Q., Liu, X. (2009). Comparison of virulence factors and expression of specific genes between uropathogenic Escherichia coli and avian pathogenic E. coli in a murine urinary tract infection model and a chicken challenge model. Microbiology, 155(Pt 5): 1634-1644.
54. : H7 using chicken immunoglobulin Y. Immunology letters, 106(2):191-3.
55. Zhao, L., Gao, S., Huan, H., Xu, X., Zhu, X., Yang, W., Gao, Q., Liu, X. (2009). Comparison of virulence factors and expression of specific genes between uropathogenic Escherichia coli and avian pathogenic E. coli in a murine urinary tract infection model and a chicken challenge model. Microbiology, 155(Pt 5): 1634-1644.
56. Nipane, S. (2012). Effect of Spirulina supplementation on growth performance of broilers. Indian Journal of Veterinary Research (The), 21(1), 66-69.
57. Mirzaie, S., Zirak-Khattab, F., Hosseini, S. A., & Donyaei-Darian, H. (2018). Effects of dietary Spirulina on antioxidant status, lipid profile, immune response and performance characteristics of broiler chickens reared under high ambient temperature. Asian-Australasian journal of animal sciences, 31(4), 556.
58. Mohammad Shirazi, R. H. S., Tala, M., Anvar, S. A. A., Nowruzi, B., Saeidi, Z., & Negahban, M. (2021). Investigating Nitrate and Nitrite Concentrations in Drinking Water of Five Districts in Tehran and Assessing the Presence of Nitrate Reducing Bacteria. Journal of Chemical Health Risks, 11(3).
59. Nowruzi, B. (2024). Industrial application of Natural Phycocyanin Edible Pigment isolated from Spirulina platensis in Preparation of fortified ice cream with emphasize on microbial and antioxident properties. Journal of food science and technology (Iran), 21(149), 54-80.
60. Nowruzi, B., & Bagheri, F. (2023). An Overview of the Probiotics, Prebiotics, and Metabiotics Functions of Microalgae. Journal of Biosafety, 16(3), 99-124.
61. Nowruzi, B., & Beiranvand, H. (2024a). A review of medical applications of cyanobacteria. Journal of Isfahan Medical School, 42(755), 69-83.
62. Nowruzi, B., & Beiranvand, H. (2024b). A review of medical applications of cyanobacteria. Journal of Isfahan Medical School.
63. Nowruzi, B., Jafari, M., Babaie, S., Motamedi, A., & Anvar, A. (2020). Spirulina: A healthy green sun with bioactive properties. Journal of Microbial World, 13(4), 322-348.
64. Qureshi, M., Kidd, M., & Ali, R. (1996). Spirulina platensis extract enhances chicken macrophage functions after in vitro exposure. Journal of Nutritional Immunology, 3(4), 35-45.
65. Satyaraj, E., Reynolds, A., Engler, R., Labuda, J., & Sun, P. (2021). Supplementation of diets with spirulina influences immune and gut function in dogs. Frontiers in Nutrition, 8, 667072.
66. Selim, S., Hussein, E., & Abou-Elkhair, R. (2018). Effect of Spirulina platensis as a feed additive on laying performance, egg quality and hepatoprotective activity of laying hens. European Poultry Science, 82, 1-13.
67. Seyidoglu, N., Inan, S., & Aydin, C. (2017). A prominent superfood: Spirulina platensis. Superfood and functional food the development of superfoods and their roles as medicine, 22, 1-27.
68. Shafaei Bajestani, M., Anvar, S. A. A., Nowruzi, B., & Golestan, L. (2000). Production of Cheese and Ice Cream Enriched With Biomass and Supernatant of Spirulina platensis With Emphasis on Organoleptic and Nutritional Properties. Iranian Journal of Veterinary Medicine, 18(2), 263-278.
69. Shanmugapriya, B., Babu, S. S., Hariharan, T., Sivaneswaran, S., & Anusha, M. (2015). Dietary administration of Spirulina platensis as probiotics on growth performance and histopathology in broiler chicks. Int. J. Recent Sci. Res, 6(2), 2650-2653.
70. Sugiharto, S., Yudiarti, T., Isroli, I., & Widiastuti, E. (2018). Effect of feeding duration of Spirulina platensis on growth performance, haematological parameters, intestinal microbial population and carcass traits of broiler chicks. South African Journal of Animal Science, 48(1), 98-107.
71. Valikboni, S. Q., Anvar, S. A. A., & Nowruzi, B. (2024). Study of the effect of phycocyanin powder on physicochemical characteristics of probiotic acidified feta-type cheese during refrigerated storage. Nutrire, 49(2), 41.
Frequency of omp T, iss and pap GII genes in Escherichia coli isolated from poultry colibacillosis in Tabriz city
Farnaz Jafari1, Saman Mahdavi2*
1- MSc, Department of Microbiology, Maragheh Branch, Islamic Azad University, Maragheh, Iran
2- Associate Professor, Department of Microbiology, Maragheh Branch, Islamic Azad University, Maragheh, Iran
Received:19 August 2023 Accepted: 30 September 2024
Abstract
Colibacillosis is one of the most common diseases in the poultry industry, which causes a lot of economic losses every year. The aim of this research was to study of the frequency of omp T, iss and pap GII genes in Escherichia coli isolated from poultry colibacillosis in Tabriz city. 100 samples of Escherichia coli isolated from poultry colibacillosis (in 2021) were phenotypically identified by biochemical and staining methods. Then, the frequency of omp T, iss and pap GII genes in these isolates was investigated by Multiplex PCR method. The results showed that the frequency of iss, omp T and pap GII genes in the tested Escherichia coli samples were 33%, 14% and 22%, respectively. Also, 1% of the tested isolates contained all three mentioned genes simultaneously. 23 negative samples were observed in terms of the presence of studied genes. Considering the presence of iss, omp T and pap GII genes in Escherichia coli isolated from poultry, it can be concluded that these genes can be effective factors in the extraintestinal infections. Also, iss gene, due to having the highest frequency among the studied genes, can potentially be introduced as the most important pathogenic factor in Escherichia coli isolated from poultry.
Keywords: Escherichia coli, Poultry colibacillosis, Virulence genes
* Corresponding Author: Saman Mahdavi
Address: Department of Microbiology, Maragheh Branch, Islamic Azad University, Maragheh, Iran
E. mail: S.Mahdavi@iau-maragheh.ac.ir