The Effect of an Incremental Swimming Training Period on CXCR4 Gene Expression in Lung Tissue in a Benzo[a]pyrene-Induced Lung Cancer Model in Balb/c Mice
محورهای موضوعی : Journal of Physical Activity and HormonesRaheleh Kaka 1 , Elaheh Heidarnia 2 , Seyed Ali Hosseini 3
1 - Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran
2 - Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran
3 - Department of Physical Education and Sports Medicine, Marv.C., Islamic Azad University, Marvdasht, Iran
کلید واژه: Swimming training, CXCR4, Lung cancer, Physical activity,
چکیده مقاله :
Introduction: Lung cancer is one of the most lethal malignancies, with smoking and air pollution being its primary risk factors. Early diagnosis and treatment improve survival rates. Studies suggest that inhibiting the CXC motif chemokine receptor type 4 (CXCR4) gene may offer a novel approach to controlling tumor growth and reducing metastasis. This study investigated the effects of incremental swimming training on CXCR4 expression in mice with benzo[a]pyrene (BZP)-induced lung cancer.
Material & Methods: In this experimental study, 12 male Balb/c mice (8–10 weeks old, 18–22 g) were induced with lung cancer via 100 mg/kg BZP injection and divided into two groups: a diseased control group (BZP) and a diseased + exercise group (BZP+ST). Six healthy mice served as the healthy control group (HC). The BZP+ST group underwent a 10-week swimming protocol (3 sessions/week), with durations gradually increasing from 15 to 40 minutes and carrying a load equivalent to 2% of their body weight. Data were analyzed using one-way ANOVA and Tukey’s post hoc test in SPSS v.22 (significance level: P ≤ 0.05).
Results: Final body weight was significantly lower in the BZP group compared to HC (P = 0.001), but improved in BZP+ST versus BZP (P = 0.001). CXCR4 expression was elevated in both BZP and BZP+ST groups compared to HC; however, swimming exercise led to a relative reduction in CXCR4 in the BZP+ST group versus BZP.
Conclusion: Incremental swimming training may suppress tumor growth and metastasis in lung cancer by downregulating CXCR4 expression and improving weight metrics. These findings highlight the potential of physical activity as an effective therapeutic strategy for lung cancer management, warranting further research.
Introduction: Lung cancer is one of the most lethal malignancies, with smoking and air pollution being its primary risk factors. Early diagnosis and treatment improve survival rates. Studies suggest that inhibiting the CXC motif chemokine receptor type 4 (CXCR4) gene may offer a novel approach to controlling tumor growth and reducing metastasis. This study investigated the effects of incremental swimming training on CXCR4 expression in mice with benzo[a]pyrene (BZP)-induced lung cancer.
Material & Methods: In this experimental study, 12 male Balb/c mice (8–10 weeks old, 18–22 g) were induced with lung cancer via 100 mg/kg BZP injection and divided into two groups: a diseased control group (BZP) and a diseased + exercise group (BZP+ST). Six healthy mice served as the healthy control group (HC). The BZP+ST group underwent a 10-week swimming protocol (3 sessions/week), with durations gradually increasing from 15 to 40 minutes and carrying a load equivalent to 2% of their body weight. Data were analyzed using one-way ANOVA and Tukey’s post hoc test in SPSS v.22 (significance level: P ≤ 0.05).
Results: Final body weight was significantly lower in the BZP group compared to HC (P = 0.001), but improved in BZP+ST versus BZP (P = 0.001). CXCR4 expression was elevated in both BZP and BZP+ST groups compared to HC; however, swimming exercise led to a relative reduction in CXCR4 in the BZP+ST group versus BZP.
Conclusion: Incremental swimming training may suppress tumor growth and metastasis in lung cancer by downregulating CXCR4 expression and improving weight metrics. These findings highlight the potential of physical activity as an effective therapeutic strategy for lung cancer management, warranting further research.
1. Abekova A, Islamov R. ChemoProtective effects of new iodine coordinated compound in benzo [a] pyrene-induced lung cancer in BALB/c mice. In: BIO Web of Conferences. EDP Sciences; 2024. Vol. 100, p. 03001. doi: 10.1051/bioconf/202410003001
2. Adams SC, et al. The benefits of exercise in cancer patients: an overview. Curr Sports Med Rep. 2018;17(4):123-32. doi: 10.1249/JSR.0000000000000470
3. Argilés JM, Busquets S, Stemmler B, López-Soriano FJ. Cancer cachexia: understanding the molecular basis. Nat Rev Cancer. 2014;14(11):754-62. doi: 10.1038/nrc3829
4. Baggish AL, Hale A, Weiner RB, Lewis GD, Systrom D, Wang F, et al. Dynamic regulation of circulating microRNA during acute exhaustive exercise and sustained aerobic exercise training. J Physiol. 2011;589(16):3983-94. doi: 10.1113/jphysiol.2011.213363
5. Bourke L, et al. Physical activity and exercise interventions for people with cancer: a systematic review. Cochrane Database Syst Rev. 2018;9:CD011007. doi: 10.1002/14651858.CD011007.pub2
6. Burger JA, Kipps TJ. CXCR4: a key receptor in the crosstalk between tumor cells and their microenvironment. Blood. 2006;107(5):1761-7. doi: 10.1182/blood-2005-08-3182
7. Coen PM, Goodpaster BH. Role of intramyocellular lipids in human health. Trends Endocrinol Metab. 2012;23(8):391-8. doi: 10.1016/j.tem.2012.05.009
8. Fahlman M, et al. Cardiovascular and respiratory responses of children to swimming training. Med Sci Sports Exerc. 2000;32(5):S209.
9. Fearon KC, Glass DJ, Guttridge DC. Cancer cachexia: mediators, signaling, and metabolic pathways. Cell Metab. 2012;16(2):153-66. doi: 10.1016/j.cmet.2012.06.011
10. Fei Z, Li D, Li K, Zhou M, Li Y, Li Y, et al. Detraining after tumor-bearing accelerates tumor growth while continuous training decreases tumor growth in mice. J Tradit Chin Med Sci. 2020;7(1):75-81. doi: 10.1016/j.jtcms.2020.01.007
11. Gonzalez JR, et al. Benzo[a]pyrene-induced lung cancer in mice. Cancer Lett. 2013;341(1):23-9. doi: 10.1016/j.canlet.2013.07.022
12. Gorr T, et al. Using Balb/c mice as a model for lung cancer research. Transl Lung Cancer Res. 2019;8(1):65-74. doi: 10.21037/tlcr.2018.12.06
13. Hardee JP, Counts BR, Carson JA. Understanding the role of exercise in cancer cachexia therapy. Am J Lifestyle Med. 2019;13(1):46-60. doi: 10.1177/1559827617725283
14. Hattori K, et al. Roles of chemokine receptor CXCR4 in cancer metastasis. Cancer Res. 2004;64(4):1001-5. doi: 10.1158/0008-5472.CAN-03-3198
15. Hojman P, Dethlefsen C, Brandt C, Hansen J, Pedersen L, Pedersen BK. Exercise-induced muscle-derived cytokines inhibit mammary cancer cell growth. Am J Physiol Endocrinol Metab. 2011;301(3):E504-10. doi: 10.1152/ajpendo.00520.2010
16. Javed R, Abbas T, Khan AH, Daud A, Bukhari A, Alharbey R. Deep learning for lungs cancer detection: a review. Artif Intell Rev. 2024;57(8):197. doi: 10.1007/s10462-024-10852-5
17. Mailing LJ, Allen JM, Buford TW, Fields CJ, Woods JA. Exercise and the gut microbiome: a review of the evidence, potential mechanisms, and implications for human health. Exerc Sport Sci Rev. 2019;47(2):75-85. doi: 10.1249/JES.0000000000000183
18. Mirdar Harijani S, Musavi N. The effect of 12 weeks of submaximal swimming training on immunoreactivity of Ras and Raf-1 in lung epithelial cells of Wistar rats exposed to carcinogen NN. Res Sport Med Technol. 2020;18(19):113-26.
19. Myrie L, et al. Exercise in lung cancer patients. Oncol Rep. 2019;41(2):711-20. doi: 10.3892/or.2018.6889
20. Paceli R, Cal R, Santos C, Morais A, Neiva C, Cordeiro A, et al. Anaerobic exercise decreases the progression of lung cancer in experimental mice.
21. Pedersen BK, Saltin B. Exercise as medicine – evidence for prescribing exercise as therapy in 26 different chronic diseases. Scand J Med Sci Sports. 2015;25(Suppl 3):1-72. doi: 10.1111/sms.12581
22. Radak Z. Exercise improves ROS/RNS balance in the liver of old rats. Free Radic Res. 2013;47(6-7):421-6. doi: 10.3109/10715762.2013.791022
23. Richardson PG, et al. Targeting CXCR4 in cancer therapy: the potential of CXCR4 inhibitors in treatment strategies. Clin Cancer Res. 2013;19(10):3234-43. doi: 10.1158/1078-0432.CCR-12-3603
24. Schmitz KH, et al. Physical activity and the risk of breast cancer: the role of physical activity in the treatment of breast cancer. Cancer Epidemiol Biomarkers Prev. 2010;19(10):2488-500. doi: 10.1158/1055-9965.EPI-10-0345
25. Semenza GL. Hypoxia-inducible factors in physiology and medicine. Cell. 2012;148(3):399-408. doi: 10.1016/j.cell.2012.01.021
26. Sharma R. Mapping of global, regional and national incidence, mortality and mortality-to-incidence ratio of lung cancer in 2020 and 2050. Int J Clin Oncol. 2022;27(4):665-75. doi: 10.1007/s10147-021-02086-7
27. Simpson RJ, Kunz H, Agha N, Graff R. Exercise and the regulation of immune functions. Prog Mol Biol Transl Sci. 2015;135:355-80. doi: 10.1016/bs.pmbts.2015.08.001
28. Sonveaux P. Targeting lactate-fueled respiration selectively kills hypoxic tumor cells. In: Keystone symposium on Metabolism and Cancer Progression.
29. Spano JP, Andre F, Morat L, Sabatier L, Besse B, Combadiere C, et al. Chemokine receptor CXCR4 and early-stage non-small cell lung cancer: pattern of expression and correlation with outcome. Ann Oncol. 2004;15(4):613-7. doi: 10.1093/annonc/mdh136
30. Stanford KI, Goodyear LJ. Exercise and the regulation of adipose tissue metabolism. Prog Mol Biol Transl Sci. 2014;121:175-201. doi: 10.1016/B978-0-12-800101-1.00006-2
31. Torre LA, et al. Global cancer statistics, 2016. CA Cancer J Clin. 2016;66(1):7-30. doi: 10.3322/caac.21332
32. Zhan M, et al. CXCR4 expression and its role in lung cancer progression. J Cancer Res Clin Oncol. 2020;146(6):1449-63. doi: 10.1007/s00432-020-03215-6
|
Physical Activity and Hormones (J Physic Act Horm) Vol. 6 Spring 2025 |
|
The Effect of an Incremental Swimming Training Period on CXCR4 Gene Expression in Lung Tissue in a Benzo[a]pyrene-Induced Lung Cancer Model in Balb/c Mice
ABSTRACT
Introduction: Lung cancer is one of the most lethal malignancies, with smoking and air pollution being its primary risk factors. Early diagnosis and treatment improve survival rates. Studies suggest that inhibiting the CXC motif chemokine receptor type 4 (CXCR4) gene may offer a novel approach to controlling tumor growth and reducing metastasis. This study investigated the effects of incremental swimming training on CXCR4 expression in mice with benzo[a]pyrene (BZP)-induced lung cancer.
Material & Methods: In this experimental study, 12 male Balb/c mice (8–10 weeks old, 18–22 g) were induced with lung cancer via 100 mg/kg BZP injection and divided into two groups: a diseased control group (BZP) and a diseased + exercise group (BZP+ST). Six healthy mice served as the healthy control group (HC). The BZP+ST group underwent a 10-week swimming protocol (3 sessions/week), with durations gradually increasing from 15 to 40 minutes and carrying a load equivalent to 2% of their body weight. Data were analyzed using one-way ANOVA and Tukey’s post hoc test in SPSS v.22 (significance level: P ≤ 0.05).
Results: Final body weight was significantly lower in the BZP group compared to HC (P = 0.001), but improved in BZP+ST versus BZP (P = 0.001). CXCR4 expression was elevated in both BZP and BZP+ST groups compared to HC; however, swimming exercise led to a relative reduction in CXCR4 in the BZP+ST group versus BZP.
Conclusion: Incremental swimming training may suppress tumor growth and metastasis in lung cancer by downregulating CXCR4 expression and improving weight metrics. These findings highlight the potential of physical activity as an effective therapeutic strategy for lung cancer management, warranting further research.
Keywords: Swimming training, CXCR4, Lung cancer, Physical activity.
*Correspondence: Heidarnia.elaheh@iau.ac.ir |
Received: Mar 2025; Revised: Apr 2025; Accepted: May 2025.
DOI: ---- |
1. Introduction
Lung cancer, as a serious and life-threatening disease, is one of the most common cancers worldwide. This condition involves uncontrolled changes in lung cells, leading to the growth of malignant tumors. In many cases, the disease is diagnosed at advanced stages, reducing the chances of effective treatment and patient survival. According to the World Health Organization (WHO) in 2020, approximately 2.21 million new cases of lung cancer were recorded, with nearly 1.8 million deaths attributed to the disease (Javad et al., 2024; Sharma, 2022). These statistics highlight the urgent need for early detection and effective treatment.
Early diagnosis of lung cancer can significantly impact prognosis and treatment outcomes. The highest-risk groups include smokers and individuals exposed to environmental pollutants such as dust and toxic gases. While advances in imaging techniques like CT scans and X-rays aid in early tumor detection, awareness of initial symptoms—such as persistent cough, chest pain, unexplained weight loss, and breathing difficulties—is equally crucial.
Multiple factors contribute to lung cancer development, with smoking being the primary cause, accounting for roughly 85% of cases (Torre et al., 2016). Other risk factors include exposure to environmental carcinogens (e.g., asbestos, radon, and industrial chemicals) and genetic predisposition. Recent studies have identified the chemokine receptor CXC motif chemokine receptor type 4 (CXCR4) as a key player in lung cancer progression. Overexpression of CXCR4 in lung tumors is linked to metastatic processes and poorer prognosis (Zhan et al., 2020). This receptor facilitates cancer cell migration and aggregation (Hattori et al., 2004), and its elevated expression in lung tumor models suggests its potential as a biomarker for disease progression. Targeting CXCR4 may thus offer a novel therapeutic strategy to inhibit metastasis and improve clinical outcomes (Richardson et al., 2013).
Alongside molecular research, physical activity has emerged as a protective factor against cancer and a means to enhance treatment efficacy. Regular exercise positively impacts immune function, reduces inflammation, and improves quality of life in cancer patients (Schmitz et al., 2010). Among various exercises, swimming—a low-impact activity—is particularly recommended for its cardiovascular benefits and minimal strain on the body. Swimming enhances respiratory capacity and muscle strength, alleviating symptoms in cancer patients (Fahlman et al., 2008; Adams et al., 2018). Studies suggest that exercise may modulate cancer-related aberrant phenotypes and promote tissue repair (Brooks et al., 2018), potentially downregulating CXCR4 expression to suppress metastasis (Myers et al., 2018).
This study investigates the effects of an incremental swimming exercise regimen on CXCR4 gene expression in lung tissue using a benzopyrene-induced lung cancer model in Balb/c mice. Balb/c mice are a standard model due to their genetic similarity to humans in immune responses (Gorr et al., 2019), and benzopyrene is a well-established carcinogen for experimental studies (Gonzalez et al., 2013). By exploring the relationship between exercise and cancer-related gene expression, this research aims to provide empirical evidence for integrating physical activity as an adjunct therapy in lung cancer treatment. The ultimate goal is to develop strategies that leverage exercise to modify gene expression (e.g., CXCR4) and mitigate disease progression.
2. Methodology
2.1. Materials and methods
This experimental and fundamental study.
2.2. Participants
This study 18 male Balb/c mice aged 8–10 weeks (weighing 18–22 g) were obtained from the Pasteur Institute of Iran’s animal breeding center. After transfer to the animal exercise physiology laboratory at Pishthazan Higher Education Institute of Shiraz, the mice were acclimatized to laboratory conditions for one week. All experimental procedures strictly adhered to ethical guidelines for laboratory animal research and were supervised by the Animal Ethics Committee of Islamic Azad University, Shiraz Branch. Throughout the study, the animals were housed under standard environmental conditions:Temperature: 22 ± 3°C; Humidity: 40–60%; Ventilation: Adequate airflow; Light/dark cycle: 12-hour intervals.
2.3. Measurements
Induction of Lung Cancer with Benzopyrene: To induce lung cancer, 12 laboratory mice were fasted for 12 hours prior to intraperitoneal (IP) injection. Each mouse received 100 mg/kg of benzopyrene (BZP) (Sigma-Aldrich, Product Code: B1760) dissolved in 1.2 mL of corn oil, followed by an IP injection of 10 international units (IU) of the BZP solution (Abekova et al., 2024). Fourteen days post-injection - based on established literature indicating tumor development and inflammation typically manifest within this period - the mice were divided into three experimental groups: After 14 days of injection, based on reliable sources that acknowledge that inflammation and tumor appear during this period, the mice were divided into three groups: healthy control group (HC), patient control group (BZP), and swimming training group + BZP (BZP + ST). In this study, 6 healthy mice were considered as healthy control group, in order to compare the effects of the experiment on the studied variables.
2.4. Intervention
2.4.1 Swimming training protocol
Swimming training in this study was carried out in a special animal pool with dimensions of 110 cm wide and water temperature of 32 ° C. This protocol includes two phases of familiarization and implementation of the main program. In the familiarization phase, laboratory mice were familiarized with the water environment and swimming training for 10 days. In the main phase, inspired by previous research and with minor modifications, the mice will train for twelve weeks, in five sessions per week. In this program, in the first week, the mice were active in the pool for 15 minutes. Subsequently, the training time was gradually increased and by the tenth week, the duration of each session reached 30 minutes. In the final two weeks, the duration of each session was increased to 40 minutes. Also, to comply with the principle of no overload and to prevent excessive pressure, the mice will carry a weight equivalent to 2% of their body weight, attached to the tail, while swimming (Mirdar Harijani and Musavi,2020; Paceli et al. 2012; Fei et al. 2020).
2.4.2 Dissection, biopsy and weight assessment
Furthermore, 48 hours after the last training session and in a 12-hour fast, the weight of all rats was measured using a digital scale made in Germany, type Kern, with a sensitivity of 0.01 g. Then, the rats were anesthetized using intraperitoneal injection of ketamine at a dose of 25 mg/kg and xylazine at a dose of 65 mg/kg, which is manufactured by Alfasan, Netherlands. After ensuring complete anesthesia, the thoracic cavity of the animals was opened. Then, by removing the connective tissues, the lung tissue was completely extracted. The lung tissue was immediately transferred after washing at a temperature of -70°C.
2.4.3 CXCR4 measurement method in lung tissue
To measure CXCR4 gene expression levels in lung tissue, RNA extraction was performed using a column RNA extraction kit (FavorPrep™ Tissue Total RNA Kit) with catalog number (FATRK 001) made in Taiwan according to the manufacturer's kit instructions. After RNA extraction, 5 μl of it was placed on an electrophoresis gel to ensure its quality, and its absorption quality was also checked on a Picodrop device made by Sigma-Aldrich, USA, at a wavelength of 260 nm. Then, DNA synthesis was prepared from the extracted RNA using a Fermentase Kit from Thermo Scientific with catalog number (K1621). Also, reverse transcription reaction was performed using the RevertAid First Strand cDNA Synthesis Kit. Next, to examine the CXCR4 gene expression levels using Real-time PCR, all primers (Table 1) were designed using Allele IDv7.8 software, and the Actin Beta (ACTB) gene was used as an internal control. Next, after ensuring the efficiency of the primers, the product was placed in the wells of the Real-time PCR device to amplify the genes in certain time and temperature cycles. After reaching the gene expression threshold cycle (CT), which turns green in the monitor device, the gene expression levels were calculated using the formula 2-ΔΔCt.
Table 1. Primer sequences of genes used in the research
Genes | Primer Sequences | Sizes (bp) |
TPB | Forward: 5’- GCGGGGTCATGAAATCCAGT-3’ | 147 |
| Reverse: 5’- AGTGATGTGGGGACAAAACGA -3’ |
|
CXCR4 | Forward: 5’- TTTGGTGCTCCGGTAACCAC -3’ | 267 |
| Reverse: 5’- TGTCCGTCATGCTCCTTAGC -3’ |
|
2.5. Statistical Methods
First, the Shapiro-Wilk test was used to check the normality of the data distribution. Then, the paired t-test (dependent) was used to compare the weight changes before and after the intervention. To examine the differences between the groups, the one-way analysis of variance (ANOVA) test was used, and if significant, the Tukey post hoc test was used to determine the location of the differences. The data were analyzed using SPSS version 22 software. Also, the significance level of all tests was considered to be 0.05 or less (P ≤ 0.05).
3. Results
The results of the paired t-test showed that the weight of the laboratory mice in the healthy control group in the last week was significantly higher than their weight in the pre-test (P=0.001 and t=-6.84), but in the BZP group, after the intervention, a significant decrease in weight was observed compared to the pre-test (P=0.03 and t=2.81). In contrast, in the swimming training (ST) group, no significant difference was observed between the weight values in the pre-test and post-test (P=0.056 and t=-2.47). Furthermore, the results showed that the post-test body weight values (P=0.001 and F=34.54) were significantly different in the research groups. In other words, the post-test weight in the BZP group was significantly lower than that in the healthy control group (HC) (P=0.001), but in the swimming training group (ST), it was significantly higher than that in the BZP group (P=0.001) (Figure 1).
On the other hand, the results of one-way ANOVA analysis showed that there was a significant difference between the groups at the post-test (P=0.001, F=9 and 2.153). The results of the Tukey post-test showed that the CXCR4 gene expression values in lung tissue in the BZP group (P=0.001) and the BZP+ST group (0.017) were significantly higher than those in the HC group (Figure 2).
Figure 1. Weight of laboratory mice in pre-test and post-test in the three research groups. *** (P=0.001) Significant increase in weight in the post-test of the HC group compared to the pre-test of this group; ˅ (P=0.05) Significant decrease in weight in the post-test of the BZP group compared to the pre-test of this group; *** (P=0.001) Significant decrease in weight in the post-test of the BZP group compared to the post-test weight of the HC group; ### (P=0.001) Increase in weight in the post-test of the ST group compared to the post-test of the BZP group
Figure 2: CXCR4 gene expression levels in lung tissue in laboratory mice in the three research groups. *** (P=0.001) significant increase compared to the HC group; ### (P=0.017) significant increase compared to the group
4. Discussion
This study aimed to investigate the effects of incremental swimming training on CXCR4 gene expression in lung tissue and weight indices in a benzopyrene-induced lung cancer model using Balb/c mice. The findings demonstrated that swimming training significantly mitigated cancer-induced body weight loss and downregulated CXCR4 gene expression compared to the cancer control group (BZP).
These results align with previous studies highlighting the role of physical activity in modulating inflammatory and metastatic processes in cancer (Pedersen & Saltin, 2015; Hojman et al., 2011). The observed weight loss in the BZP group is indicative of cancer cachexia, a metabolic syndrome characterized by progressive muscle and adipose tissue wasting (Fearon et al., 2012). Research suggests that activation of inflammatory pathways (e.g., NF-κB) and elevated proinflammatory cytokines (TNF-α, IL-6) play a pivotal role in cachexia development (Argilés et al., 2014).
In contrast, weight stability in the swimming group may be attributed to exercise-induced preservation of muscle mass and improved energy balance. Endurance exercises such as swimming counteract cancer-related catabolism by enhancing muscle protein synthesis and reducing muscle protein degradation via the AKT/mTOR pathway (Hardee et al., 2019).
Research has demonstrated that physical activity enhances insulin sensitivity and regulates visceral fat storage by lowering leptin levels and elevating adiponectin (Stanford & Goodyear, 2014). These effects are likely mediated through the suppression of the JNK/IRS-1 pathway, a key contributor to insulin resistance (Coen & Goodpaster, 2012).
On the other hand, the significant increase in CXCR4 gene expression in the BZP and BZP+ST groups compared to the healthy control group confirms the role of this gene in lung cancer progression. CXCR4 is a chemokine receptor that interacts with its ligand (SDF-1) and facilitates the migration of cancer cells to distant sites (metastasis) (Burger and Kipps, 2006). Clinical studies have shown that high CXCR4 expression is associated with poor prognosis and metastasis to lymph nodes and bones in patients with lung cancer (Spano et al. 2004). The relative decrease in CXCR4 expression in the swimming training group (although still higher than the healthy control group) is probably due to the effect of exercise on signaling pathways related to the transcription factor HIF-1α. Under exercise-induced hypoxia, HIF-1α is activated and inhibits CXCR4 binding by reducing SDF-1 production (Semenza 2012). In addition, exercise may regulate the expression of this gene at the post-transcriptional level by increasing the level of miR-146a, which is a translational inhibitor of CXCR4 (Baggish et al. 2011). Possible mechanisms of exercise’s effect on lung cancer include: first Modulation of the immune system: Exercise enhances the antitumor immune response by increasing the activity of NK and cytotoxic T cells (Simpson et al. 2015). second Reduction of oxidative stress: Physical activity reduces DNA damage caused by reactive oxygen species (ROS) by increasing the expression of antioxidant enzymes such as SOD and GPx (Radak 2013). third Regulation of glucose metabolism: Cancer cells are highly dependent on glycolysis for energy and biomass. Excessive production of lactate (the end product of glycolysis under anaerobic conditions) causes the tumor microenvironment to become acidic, which aids cancer cell migration and metastasis. Inhibition of glycolysis has been investigated as a therapeutic strategy in cancer. Therefore, exercise inhibits the growth of cancer cells by reducing lactate levels and the acidity of the tumor microenvironment (Sonveaux et al. 2008). Fourth Effect on intestinal microbiota: Recent studies show that exercise increases butyrate-producing bacteria that have anti-inflammatory and anti-tumor properties (Mailing et al. 2019). Regarding the limitations of the research, the following can be mentioned: A- Small sample size and use of an animal model limit the generalization of the results to humans. Lack of investigation of other markers associated with metastasis such as MMP-9 and VEGF. Need for long-term studies to evaluate the effect of exercise on patient survival. Therefore, it is suggested that future research should investigate the effect of combining exercise with targeted therapies such as CXCR4 inhibitors (such as Plerixafor). Also, advanced techniques such as RNA sequencing should be used to identify gene networks affected by exercise training.
5. Conclusion
The findings of this study suggest that incremental swimming training—by reducing CXCR4 gene expression and improving metabolic indicators—can serve as a complementary therapeutic approach in lung cancer management. While the exact mechanisms warrant further research, current evidence supports the modulatory role of exercise in influencing the tumor microenvironment and metastatic pathways.
6. Acknowledgment
The researchers hereby thank and appreciate all those who contributed to this research.
Conflict of interests: The authors declare that there is no conflict of interest regarding the publication of this manuscript.
References
1. Abekova A, Islamov R. ChemoProtective effects of new iodine coordinated compound in benzo [a] pyrene-induced lung cancer in BALB/c mice. In: BIO Web of Conferences. EDP Sciences; 2024. Vol. 100, p. 03001. doi: 10.1051/bioconf/202410003001
2. Adams SC, et al. The benefits of exercise in cancer patients: an overview. Curr Sports Med Rep. 2018;17(4):123-32. doi: 10.1249/JSR.0000000000000470
3. Argilés JM, Busquets S, Stemmler B, López-Soriano FJ. Cancer cachexia: understanding the molecular basis. Nat Rev Cancer. 2014;14(11):754-62. doi: 10.1038/nrc3829
4. Baggish AL, Hale A, Weiner RB, Lewis GD, Systrom D, Wang F, et al. Dynamic regulation of circulating microRNA during acute exhaustive exercise and sustained aerobic exercise training. J Physiol. 2011;589(16):3983-94. doi: 10.1113/jphysiol.2011.213363
5. Bourke L, et al. Physical activity and exercise interventions for people with cancer: a systematic review. Cochrane Database Syst Rev. 2018;9:CD011007. doi: 10.1002/14651858.CD011007.pub2
6. Burger JA, Kipps TJ. CXCR4: a key receptor in the crosstalk between tumor cells and their microenvironment. Blood. 2006;107(5):1761-7. doi: 10.1182/blood-2005-08-3182
7. Coen PM, Goodpaster BH. Role of intramyocellular lipids in human health. Trends Endocrinol Metab. 2012;23(8):391-8. doi: 10.1016/j.tem.2012.05.009
8. Fahlman M, et al. Cardiovascular and respiratory responses of children to swimming training. Med Sci Sports Exerc. 2000;32(5):S209.
9. Fearon KC, Glass DJ, Guttridge DC. Cancer cachexia: mediators, signaling, and metabolic pathways. Cell Metab. 2012;16(2):153-66. doi: 10.1016/j.cmet.2012.06.011
10. Fei Z, Li D, Li K, Zhou M, Li Y, Li Y, et al. Detraining after tumor-bearing accelerates tumor growth while continuous training decreases tumor growth in mice. J Tradit Chin Med Sci. 2020;7(1):75-81. doi: 10.1016/j.jtcms.2020.01.007
11. Gonzalez JR, et al. Benzo[a]pyrene-induced lung cancer in mice. Cancer Lett. 2013;341(1):23-9. doi: 10.1016/j.canlet.2013.07.022
12. Gorr T, et al. Using Balb/c mice as a model for lung cancer research. Transl Lung Cancer Res. 2019;8(1):65-74. doi: 10.21037/tlcr.2018.12.06
13. Hardee JP, Counts BR, Carson JA. Understanding the role of exercise in cancer cachexia therapy. Am J Lifestyle Med. 2019;13(1):46-60. doi: 10.1177/1559827617725283
14. Hattori K, et al. Roles of chemokine receptor CXCR4 in cancer metastasis. Cancer Res. 2004;64(4):1001-5. doi: 10.1158/0008-5472.CAN-03-3198
15. Hojman P, Dethlefsen C, Brandt C, Hansen J, Pedersen L, Pedersen BK. Exercise-induced muscle-derived cytokines inhibit mammary cancer cell growth. Am J Physiol Endocrinol Metab. 2011;301(3):E504-10. doi: 10.1152/ajpendo.00520.2010
16. Javed R, Abbas T, Khan AH, Daud A, Bukhari A, Alharbey R. Deep learning for lungs cancer detection: a review. Artif Intell Rev. 2024;57(8):197. doi: 10.1007/s10462-024-10852-5
17. Mailing LJ, Allen JM, Buford TW, Fields CJ, Woods JA. Exercise and the gut microbiome: a review of the evidence, potential mechanisms, and implications for human health. Exerc Sport Sci Rev. 2019;47(2):75-85. doi: 10.1249/JES.0000000000000183
18. Mirdar Harijani S, Musavi N. The effect of 12 weeks of submaximal swimming training on immunoreactivity of Ras and Raf-1 in lung epithelial cells of Wistar rats exposed to carcinogen NN. Res Sport Med Technol. 2020;18(19):113-26.
19. Myrie L, et al. Exercise in lung cancer patients. Oncol Rep. 2019;41(2):711-20. doi: 10.3892/or.2018.6889
20. Paceli R, Cal R, Santos C, Morais A, Neiva C, Cordeiro A, et al. Anaerobic exercise decreases the progression of lung cancer in experimental mice.
21. Pedersen BK, Saltin B. Exercise as medicine – evidence for prescribing exercise as therapy in 26 different chronic diseases. Scand J Med Sci Sports. 2015;25(Suppl 3):1-72. doi: 10.1111/sms.12581
22. Radak Z. Exercise improves ROS/RNS balance in the liver of old rats. Free Radic Res. 2013;47(6-7):421-6. doi: 10.3109/10715762.2013.791022
23. Richardson PG, et al. Targeting CXCR4 in cancer therapy: the potential of CXCR4 inhibitors in treatment strategies. Clin Cancer Res. 2013;19(10):3234-43. doi: 10.1158/1078-0432.CCR-12-3603
24. Schmitz KH, et al. Physical activity and the risk of breast cancer: the role of physical activity in the treatment of breast cancer. Cancer Epidemiol Biomarkers Prev. 2010;19(10):2488-500. doi: 10.1158/1055-9965.EPI-10-0345
25. Semenza GL. Hypoxia-inducible factors in physiology and medicine. Cell. 2012;148(3):399-408. doi: 10.1016/j.cell.2012.01.021
26. Sharma R. Mapping of global, regional and national incidence, mortality and mortality-to-incidence ratio of lung cancer in 2020 and 2050. Int J Clin Oncol. 2022;27(4):665-75. doi: 10.1007/s10147-021-02086-7
27. Simpson RJ, Kunz H, Agha N, Graff R. Exercise and the regulation of immune functions. Prog Mol Biol Transl Sci. 2015;135:355-80. doi: 10.1016/bs.pmbts.2015.08.001
28. Sonveaux P. Targeting lactate-fueled respiration selectively kills hypoxic tumor cells. In: Keystone symposium on Metabolism and Cancer Progression.
29. Spano JP, Andre F, Morat L, Sabatier L, Besse B, Combadiere C, et al. Chemokine receptor CXCR4 and early-stage non-small cell lung cancer: pattern of expression and correlation with outcome. Ann Oncol. 2004;15(4):613-7. doi: 10.1093/annonc/mdh136
30. Stanford KI, Goodyear LJ. Exercise and the regulation of adipose tissue metabolism. Prog Mol Biol Transl Sci. 2014;121:175-201. doi: 10.1016/B978-0-12-800101-1.00006-2
31. Torre LA, et al. Global cancer statistics, 2016. CA Cancer J Clin. 2016;66(1):7-30. doi: 10.3322/caac.21332
32. Zhan M, et al. CXCR4 expression and its role in lung cancer progression. J Cancer Res Clin Oncol. 2020;146(6):1449-63. doi: 10.1007/s00432-020-03215-6
I.A.U (Shiraz Campus) Page 0 https://sanad.iau.ir/journal/jpah/
