Molecular identification of gene of the Helicobacter pylori neutrophil activating protein effective in controlling allergic asthma by PCR method
محورهای موضوعی : ایمنی شناسی
Alireza Khaleghi Khorrami
1
,
Sanaz Mehmazi
2
,
Rasul Shukri
3
,
Seyyed Shamsadin Athari
4
1 - Department of Microbiology, Faculty of Basic Sciences, Zanjan Branch, Islamic Azad University, Zanjan, Iran
2 - Department of Microbiology, Faculty of Basic Sciences, Zanjan Branch, Islamic Azad University, Zanjan, Iran
3 - Department of Microbiology, Faculty of Basic Sciences, Zanjan Branch, Islamic Azad University, Zanjan, Iran
4 - Department of Immunology, School of Medicine, Zanjan University of Medical Sciences, Zanjan, Iran
کلید واژه: Helicobacter pylori, Allergic asthma, Neutrophil activating protein,
چکیده مقاله :
Helicobacter pylori neutrophil activating protein (HP-NAP) is one of the important proteins of Helicobacter pylori (H. pylori). HP-NAP has immunomodulatory properties and directs allergic responses from Th2 to Th1. The aim of this study is the molecular identification of the HP-NAP gene native to Iran. The native strain of H. pylori was purchased from the Pasteur Institute. A specific urease test was performed, along with gram staining and microscopic observation. To identify HP-NAP in native bacteria, the PCR method was used. Finally, the PCR product was electrophoresed to detect the HP-NAP gene. After bacterial staining and microscopic observation, bent gram-negative bacteria were observed. The urease test showed a change in the urea reagent (phenol red), indicating H. pylori. The PCR test and electrophoresis revealed a 260 bp band related to the HP-NAP gene, compared with ladder 100. According to the study conducted and the confirmation of the presence of this protein in the structure of native bacteria, as well as previous studies in different regions of the world, observing the effects of this protein as an immunomodulator of the immune system, we can hope that in the future this protein will be used as a potential means to control and treat allergic diseases, especially allergic asthma.
Helicobacter pylori neutrophil activating protein (HP-NAP) is one of the important proteins of Helicobacter pylori (H. pylori). HP-NAP has immunomodulatory properties and directs allergic responses from Th2 to Th1. The aim of this study is the molecular identification of the HP-NAP gene native to Iran. The native strain of H. pylori was purchased from the Pasteur Institute. A specific urease test was performed, along with gram staining and microscopic observation. To identify HP-NAP in native bacteria, the PCR method was used. Finally, the PCR product was electrophoresed to detect the HP-NAP gene. After bacterial staining and microscopic observation, bent gram-negative bacteria were observed. The urease test showed a change in the urea reagent (phenol red), indicating H. pylori. The PCR test and electrophoresis revealed a 260 bp band related to the HP-NAP gene, compared with ladder 100. According to the study conducted and the confirmation of the presence of this protein in the structure of native bacteria, as well as previous studies in different regions of the world, observing the effects of this protein as an immunomodulator of the immune system, we can hope that in the future this protein will be used as a potential means to control and treat allergic diseases, especially allergic asthma.
[1] Gonzalo JA, Lloyd CM, Kremer L, Finger E, Martinez-A C, Siegelman MH, et al. Eosinophil recruitment to the lung in a murine model of allergic inflammation. The role of T cells, chemokines, and adhesion receptors. Journal of Clinical Investigation. 1996; 98(10): 2332-45. doi:10.1172/JCI119045
. [2] Arnold IC, Dehzad N, Reuter S, Martin H, Becher B, Taube C, et al. Helicobacter pylori infection prevents allergic asthma in mouse models through the induction of regulatory T cells. Journal of Clinical Investigation. 2011; 121(8):3088-93. doi:10.1172/JCI45041
[3] Kosunen TU, Höök-Nikanne J, Salomaa A, Sarna S, Aromaa A, Haahtela T. Increase of allergen-specific immunoglobulin E antibodies from 1973 to 1994 in a Finnish population and a possible relationship to Helicobacter pylori infections. Clinical & Experimental Allergy. 2002; 32(3): 373-8. doi:10.1046/j.1365-2222.2002.01330.x
[4] Marshall BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1984; 1(8390): 1311-5.
doi:10.1016/s0140-6736(84)91816-6
[5] Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, et al. Helicobacter pylori infection and the risk of gastric carcinoma. New England Journal of Medicine. 1991; 325(16): 1127-31. doi:10.1056/NEJM199110173251603
[6] Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, Isaacson PG. Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet. 1991; 338(8776): 1175-6. doi:10.1016/0140-6736(91)92035-z
[7] Lankarani KB, Ravanbod MR, Aflaki E, Nazarinia MA, Rajaee A. High prevalence of Helicobacter pylori infection in Behcet's disease. BMC Gastroenterology. 2014; 14: 58. doi:10.1186/1471-230X-14-58
[8] Fullerton D, Britton JR, Lewis SA, Pavord ID, McKeever TM, Fogarty AW. Helicobacter pylori and lung function, asthma, atopy and allergic disease--a population-based cross-sectional study in adults. International Journal of Epidemiology. 2009; 38(2): 419-26. doi:10.1093/ije/dyn348
[9] Matricardi PM, Rosmini F, Riondino S, Fortini M, Ferrigno L, Rapicetta M, et al. Exposure to foodborne and orofecal microbes versus airborne viruses in relation to atopy and allergic asthma: epidemiological study. British Medical Journal. 2000; 320(7232): 412-7. doi:10.1136/bmj.320.7232.412
[10] Shiotani A, Miyanishi T, Kamada T, Haruma K. Helicobacter pylori infection and allergic diseases: epidemiological study in Japanese university students. Journal of Gastroenterology and Hepatology. 2008; 23(7 Pt 2): e29-33.
doi:10.1111/j.1440-1746.2007.05107.x
[11] Chen Y, Blaser MJ. Helicobacter pylori colonization is inversely associated with childhood asthma. Journal of Infectious Diseases. 2008; 198(4): 553-60. doi:10.1086/590158
[12] Wang Y, Bi Y, Zhang L, Wang C. Is Helicobacter pylori infection associated with asthma risk? A meta-analysis based on 770 cases and 785 controls. International Journal of Medical Sciences. 2012; 9(7): 603-10. doi:10.7150/ijms.4970
[13] Nyström J, Svennerholm A-M. Oral immunization with HpaA affords therapeutic protective immunity against H.pylori that is reflected by specific mucosal immune responses. Vaccine. 2007; 25(14): 2591-8.
doi:10.1016/j.vaccine.2006.12.026
[14] Amedei A, Cappon A, Codolo G, Cabrelle A, Polenghi A, Benagiano M, et al. The neutrophil-activating protein of Helicobacter pylori promotes Th1 immune responses. Journal of Clinical Investigation. 2006; 116(4): 1092-101. doi:10.1172/JCI27177
[15] Kottakis F, Papadopoulos G, Pappa EV, Cordopatis P, Pentas S, Choli-Papadopoulou T. Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal Region even without dodecamer formation, which is a prerequisite for DNA protection--novel approaches against Helicobacter pylori inflammation. FEBS journal. 2008; 275(2): 302-17.
doi:10.1111/j.1742-4658.2007.06201.x
[16] Zanotti G, Papinutto E, Dundon W, Battistutta R, Seveso M, Giudice G, et al. Structure of the neutrophil-activating protein from Helicobacter pylori. Journal of Molecular Biology. 2002; 323(1): 125-30.
doi:10.1016/s0022-2836(02)00879-3
[17] Del Prete G, Chiumiento L, Amedei A, Piazza M, D'Elios MM, Codolo G, et al. Immunosuppression of TH2 responses in Trichinella spiralis infection by Helicobacter pylori neutrophil-activating protein. Journal of Allergy and Clinical Immunology. 2008; 122(5): 908-913.e5. doi:10.1016/j.jaci.2008.08.016
[18] Athari SS, Omidi R. Report of a patient with complex composites of hepatitis B virus, allergic asthma and diabetes. Asian Pacific Journal of Tropical Biomedicine. 2014; 4(Suppl1): S59-61. doi:10.12980/APJTB.4.2014C683
[19] Garcia R, Athari SS. Overview of relationship of allergic asthma with diet and food intake. Journal of food quality and hazards control. 2015; 2(1): 1-5.
[20] Codolo G, Mazzi P, Amedei A, Del Prete G, Berton G, D'Elios MM, et al. The neutrophil-activating protein of Helicobacter pylori down-modulates Th2 inflammation in ovalbumin-induced allergic asthma. Cell Microbiology. 2008; 10(11): 2355-63.
doi:10.1111/j.1462-5822.2008.01217.x
[21] Sudo N, Sawamura S, Tanaka K, Aiba Y, Kubo C, Koga Y. The requirement of intestinal bacterial flora for the development of an IgE production system fully susceptible to oral tolerance induction. Journal of Immunology. 1997; 159(4): 1739-45.
[22] Annagür A, Kendirli SG, Yilmaz M, Altintas DU, Inal A. Is there any relationship between asthma and asthma attack in children and atypical bacterial infections; Chlamydia pneumoniae, Mycoplasma pneumoniae and Helicobacter pylori. Journal of Tropical Pediatrics. 2007; 53(5): 313-8. doi:10.1093/tropej/fmm040
[23] Strachan DP. Hay fever, hygiene, and household size. British Medical Journal. 1989; 299(6710): 1259-60. doi:10.1136/bmj.299.6710.1259
[24] Herz U, Lacy P, Renz H, Erb K. The influence of infections on the development and severity of allergic disorders. Current Opinion in Immunology. 2000; 12(6): 632-40. doi:10.1016/s0952-7915(00)00155-2
[25] Engler DB, Reuter S, van Wijck Y, Urban S, Kyburz A, Maxeiner J, et al. Effective treatment of allergic airway inflammation with Helicobacter pylori immunomodulators requires BATF3-dependent dendritic cells and IL-10. Proceedings of the National Academy of Sciences. 2014; 111(32): 11810-5.
doi:10.1073/pnas.1410579111
[26] Wohlleben G, Erb KJ. Immune stimulatory strategies for the prevention and treatment of asthma. Current Pharmaceutical Design. 2006; 12(25): 3281-92. doi:10.2174/138161206778194114
[27] Papadopoulos NG, Konstantinou GN. Antimicrobial strategies: an option to treat allergy? Biomedicine & Pharmacotherapy. 2007; 61(1): 21-8.
doi:10.1016/j.biopha.2006.10.004
[28] Khamechian T, Movahedian AH, Ebrahimi Eskandari G, Heidarzadeh Arani M, Mohammadi A. Evaluation of the Correlation Between Childhood Asthma and Helicobacter pylori in Kashan. Jundishapur Journal of Microbiology. 2015; 8(6): e17842.
doi:10.5812/jjm.8(6)2015.17842
[29] Reibman J, Marmor M, Filner J, Fernandez-Beros ME, Rogers L, Perez-Perez GI, Blaser MJ. Asthma is inversely associated with Helicobacter pylori status in an urban population. PLoS One. 2008; 3(12): e4060.
doi:10.1371/journal.pone.0004060
[30] Blaser, Martin J et al. “Does Helicobacter pylori protect against asthma and allergy?” Gut. 2008; 57(5): 561-7. doi:10.1136/gut.2007.133462
[31] Taube C, Muller A. The role of Helicobacter pylori infection in the development of allergic asthma. Expert Review of Respiratory Medicine. 2012; 6(4): 441–9. doi:10.1586/ers.12.40
[32] Blaser MJ. The Jeremiah Metzger Lecture: global warming redux: the disappearing microbiota and epidemic obesity. Transactions of the American Clinical and Climatological Association. 2012; 123: 230-8.
[33] Blaser MJ. The theory of disappearing microbiota and the epidemics of chronic diseases. Nature Reviews Immunology. 2017; 17(8): 461-3. doi:10.1038/nri.2017.77
[34] O’Connor A, O’Morain CA, Ford AC. Population screening and treatment of Helicobacter pylori infection. Nature Reviews Gastroenterology & Hepatology. 2017; 14(4): 230-40. doi:10.1038/nrgastro.2016.195
[35] Yap TW, Leow AH, Azmi AN, Callahan DL, Perez-Perez GI, Loke MF, et al. Global fecal and plasma metabolic dynamics related to Helicobacter pylori eradication. Frontiers in Microbiology. 2017; 8: 536.
doi:10.3389/fmicb.2017.00536
[36] Abadi AT, Kusters JG. Management of Helicobacter pylori infections. BMC Gastroenterology. 2016; 16(1): 94.
[37] Lankarani KB, Honarvar B, Athari SS. The mechanisms underlying Helicobacter pylori-mediated protection against allergic asthma. Tanaffos. 2017; 16(4): 251.
[38] van Wijck Y, de Kleijn S, John-Schuster G, Mertens TCJ, Hiemstra PS, Muller A, et al. Therapeutic application of an extract of Helicobacter pylori ameliorates the development of allergic airway disease. Journal of Immunology. 2018; 200(5): 1570-9.
doi:10.4049/jimmunol.1700987
[39] Arnold IC, Hitzler I, Muller A. The immunomodulatory properties of Helicobacter pylori confer protection against allergic and chronic inflammatory disorders. Frontiers in Cellular and Infection Microbiology. 2012; 2:10. doi:10.3389/fcimb.2012.00010
[40] Sehrawat A, Sinha S, Saxena A. Helicobacter pylori neutrophil-activating protein: a potential Treg modulator suppressing allergic asthma? Frontiers in Microbiology. 2015; 6: 493. doi:10.3389/fmicb.2015.00493
[41] Permin H, Andersen LP. Inflammation, immunity, and vaccines for Helicobacter pylori. Helicobacter. 2009; 14(Suppl 1): 21-8. doi:10.1111/j.1523-5378.2005.00337.x
[42] Wijck YV, John-Schuster G, van Schadewijk A, van den Oever RL, Obieglo K, Hiemstra PS, et al. Extract of Helicobacter pylori ameliorates parameters of airway inflammation and goblet cell hyperplasia following repeated allergen exposure. International Archives of Allergy and Immunology. 2019; 180(1): 1-9.
doi:10.1159/000500598
[43] Kyburz A, Fallegger A, Zhang X, Altobelli A, Artola-Boran M, Borbet T, et al. Transmaternal Helicobacter pylori exposure reduces allergic airway inflammation in offspring through regulatory T cells. Journal of Allergy and Clinical Immunology. 2019; 143(4): 1496-e11.
doi:10.1016/j.jaci.2018.07.046
Molecular identification gene of the Helicobacter pylori neutrophil activating protein effective in controlling allergic asthma by PCR method
Abstract
Objective: Helicobacter pylori neutrophil activating protein (HP-NAP) is one of the important proteins of Helicobacter pylori (H.pylori). HP-NAP has immunomodulatory properties and directs allergic responses from Th2 to Th1. The aim of this study is the molecular identification of HP-NAP gene native to Iran.
Method: The native strain of H.pylori was purchased from the Pasteur Institute, then specific urease test was performed, as well as gram staining and observation under the microscope, and in order to identify HP-NAP in native bacteria, this was done by PCR method. Finally, the PCR product should be electrophoresed to detect the HP-NAP gene.
Results: After bacterial staining and microscopic observation, bent gram-negative bacteria were observed. Also, the result of the urease test was seen with a change in urea reagent (phenol red), which indicated H.pylori. The result of the PCR test and perform electrophoresis, the 260 bp band related it was the HP-NAP gene was seen in comparison with ladder 100.
Conclusion: According to the study conducted and the confirmation of the presence of this protein in the structure of native bacteria, as well as previous studies in different regions of the world and observing the effects of this protein as an immunomodulatory of the immune system, we can hope that in the future this protein will be used as a It has the potential to control and treat allergic diseases, especially allergic Asthma.
Key words: Helicobacter pylori, allergic asthma, neutrophil activating protein.
Graphical abstract
Introduction
H.pylori is a spiral-shaped, microaerophilic gram-negative bacterium, and according to studies conducted since 50,000 years ago, it has evolved with humans and can be considered an important risk to the health of the human population (1, 2, and 3). This bacterium infects the stomach of about 45% of the world's population and can cause stomach ulcers, gastric lymphoma and stomach cancer (4-7). Also, H.pylori infection in children can be one of the causes of iron and vitamin B12 deficiency. According to the findings, the infection with H.pylori in people who live in developing countries is more than people who live in developed countries, which can be due to the difference in the level of health in these countries (8-10).Also, the findings show that infection with H.pylori can be related to the development of bronchitis and lung cancer, however, the direct effect of H.pylori on respiratory diseases has not been fully determined to date (10-12). HP-NAP is one of the important proteins of H.pylori that during the growth of the bacterium, HP-NAP molecules are released from the bacterium and some of it is on the surface of the outer membrane of the bacterium in the form of remain connected. This protein is considered as an immunomodulatory. According to its characteristics, if the neutrophil activating factor can activate and increase the efficiency of macrophages, it can be considered as a key factor for the prevention and treatment of infection (13). This protein can strongly stimulate neutrophils, monocytes and dendritic cells and increase the production of IFN-γ and decrease IL-4, thereby directing the Th2 immune response to the Th1 response. Therefore, it is possible that HP-NAP can reduce the incidence of allergic asthma in people infected with Helicobacter pylori (14-15-17). Allergic asthma is a chronic inflammatory disease of the bronchi that is diagnosed with cough and shortness of breath and wheezing. Allergic asthma is caused by an excessive Th2 response to environmental allergens. In allergic asthma, Th2 cytokines cause the production and release of cytokines (IL-4, IL-5 and IL-13) and stimulate B cells to produce IgE, resulting in eosinophilic inflammation in the bronchi. On the other hand, they inhibit the secretion (IL-12, TNF-α, and INF-γ) related to Th1, which eventually leads to asthma attacks when observing the symptoms of atopy (22-21-20-19-18).
Recognizing, controlling, preventing and treating asthma is inevitable. An asthma attack is the result of the immune system's reaction against allergens. According to studies, some infectious diseases can affect the development of allergic disorders (23). Some bacteria can direct allergic responses from Th2 to Th1 responses by producing IFN-γ and IL-12 (25, 24). Therefore, by using some bacteria or their components that induce Th1 response, the development of allergic asthma can be prevented (26). In allergic asthma patients, stimulation of a Th1-mediated immune response can suppress Th2 responses, while if the Th1 response is insufficient, the Th2 response is high, which can ultimately lead to allergic asthma in the bronchi (19). Microbial products can be useful for maintaining the balance between Th1 and Th2 responses. Therefore, bacteria are effective in controlling and treating of asthma and can be used as potential therapeutic approach in harnessing of allergic asthma (9, 19, and 27). Recent studies have shown that an association between the presence of H.pylori containing HP-NAP and a reduced risk of asthma (28-30).
The aim of this study is to identify the molecular gene of HP-NAP effective in controlling allergic asthma by PCR method. The native bacteria of Iran should be prepared, then molecular tests PCR should be performed to confirm the presence of this peptide in native H.pylori. So that if the presence of this peptide is proven, it can be extracted for further research and for clinical research as a potential therapeutic strategy and as a New tools for the prevention and treatment of allergic asthma were investigated and used.
Method
Preparation of bacteria
Since this study was not done on native bacteria, it was decided to order and purchase the native strain of Helicobacter pylori from the Pasteur Institute of Iran. After the preparation of the bacteria, it was transferred to the laboratory for further studies by an anaerobic jar and gas pack type C.
Diagnostic tests
First, we use warm staining to observe and identify the bacteria under the microscope, then to be sure, I culture the bacteria in urea agar medium, so that if we observe the fermentation of urea by the urease enzyme of this bacteria, and as a result, the color of the medium changes from yellow to pink. Let's start the next steps clearly.
Identification of HP-NAP by PCR method
In order to determine the HP-NAP in indigenous bacteria, this work was done by PCR method. For this purpose, the genome sequence of H.pylori containing the HP-NAP gene is available under registration number AF227081.1 (from the World Gene Bank. in NCBI database) and primer design was done with the help of Gene Runner software. The sequence of reverse primers designed is as follows.
Forward primer 5'GTTTGCGGACATGTTTGACG3'
Reverse primer 5'GCAACTTGGCCAATTGATCG3'
These primers were received from Pishgam after the order. In order to perform the PCR test, DNA extraction had to be done first. For this purpose, a sufficient amount of the bacterial colony was removed by a sterile swab and placed in a micro tube containing sterile distilled water with a comparative turbidity of half. McFarland was transferred. Then DNA extraction was done by boiling method and to check the success of the genome extraction process, the Nano drop device made by ABI, USA was used, and the appropriate Dna concentration 700nanograms was measured. In the following, the DNA was extracted to determine the HP-NAP gene. It was PCR by a thermos cycler made by Gradient Analytica Gina. The PCR reaction was carried out in a final volume of 25 microliters containing 2.5microliter Master mix 2x (pishgam,Tehran,Iran) and 1 microliter of a solution containing 1 microliter primer (10 picogram) and 1.4 ng DNA template. The temperature program included an initial temperature 95C for 5 minutes, followed by 33 repeated steps including denaturation at 94°C for one minute, annealing at 58°C for one minute, and extension at 72°C for 30 seconds, and finally, one-step final elongation at 72°C for 10 minutes was performed.
PCR product electrophoresis
The product obtained from PCR should be electrophoresed to detect the HP-NAP gene, which was done by horizontal electrophoresis with One percent agarose gel. The structure of these gels is porous and the diameter of the pores is about 100 to 500 nm, and this causes molecules with sizes so, first we prepare a One percent agarose gel to make a One percent concentration gel, one gram of agarose powder is dissolved in 100 ml of TBE (Tris/Borate/EDTA) buffer, and this mixture is then It turns into a clear and uniform liquid after heating. Heat dissolves all the agarose particles in the buffer. Then we fill the electrophoresis tank with the same buffer that we used to prepare the gel. After preparing the gel and creating suitable holes with a special comb, add 2 microliters of the PCR product into the gel and after connecting the electrodes, we turn on the device, since the DNA molecules have a negative charge, when they are placed on the gel and under an electric current, they move towards the positive electrode. In this situation, the separation of DNA molecules is done only based on their size. The movement of short DNA strands is faster than longer molecules, so it is easier to separate DNA molecules of different sizes. As we mentioned before, the tracking of samples is done by adding fluorescent dyes in the gel well. Used Safe stain (pishgam,Tehran,Iran) for this purpose.
After the electrophoresis is finished and the electric current is cut off, a DNA marker or ladder is used as a standard to measure the DNA band resulting from PCR. bp was related to HP-NAP, we look for the size of the band obtained from the PCR product on the gel, for this purpose we use the 100-2000 bp ladder (pishgam,Tehran,Iran), and observe the result using the Gel documentation machine and take a picture of it and search for the desired size we do.
Result
At first, transferred a small amount from the plate containing the desired bacteria to a microscope slide to stain the bacteria and look for gram-negative bacteria, the result of which can be seen in) Figure1 (. After staining and observing the absence of contamination of the plate with other bacteria, we used a specific urease test inside the test tube. These bacteria convert the urea in the culture medium into ammonia, carbon dioxide and water. Ammonia resulting from the decomposition of urea causes the alkalinity of the environment, which is shown by the change in the urea reagent (phenol red) and the change in the color of the environment from yellow to light pink, the result of which can be seen in (Figure 2).
Molecular test: The main goal of this research is to determine the HP-NAP gene using the PCR technique. After performing this technique and electrophoresis of the product obtained from the PCR, the image obtained from the gel documentation machine was analyzed and considering that after the design of the primer band 260 bp was related to HP-NAP gene, the appropriate laser should be used to detect DNA bands. As a result, it is better to use a 100 to 2000 bp ladder, which is capable of detecting 100 bp DNA fragments. In the figure below, the 260 bp band related to the HP-NAP gene can be seen quite clearly compared to the 200 to 300 bp ladder band, so as a result, this protein it was also detected in the native bacteria of Iran for further studies (Figure 3).
Fig 1. Gram staining of bacteria and observation under the microscope with x400 magnification
Fig 2: Urease test: the left tube of the negative sample and the right tube of the positive sample (H.pylori)
Fig 3. The result of HP-NAP electrophoresis on one percent agarose gel.
Discussion
Helicobacter pylori, as an old bacterium, often settles in the human stomach and sticks to its cells. Helicobacter pylori is probably one of the microflora of human stomach. With the improvement of people's lifestyle and health conditions and the eradication of Helicobacter pylori, its prevalence has decreased drastically in developed countries, while the incidence of asthma and allergic diseases has increased greatly (31-32). To confirm the "disappearing microbiota" theory, Blaser states the loss of certain bacterial species from the old microbiota that can change the immune system and its cognitive functions, which should be developed early in our lives, and this change can lead to increased sensitivity to some diseases.Also, the loss of these microbiota, which is observed in most parts of the world, can lead to the emergence of modern diseases. These cases encourage us to understand the reasons for the loss of microbiota (5-33). Although eradicating this bacterium reduces the incidence of indigestion, stomach ulcers and stomach malignancies. However, there are also concerns for the use of its complete eradication, including resistance to foreign microbes and the increased prevalence of disorders that are inversely related to H.pylori infection, including obesity, asthma, GERD, and Barrett's esophagus (34,35). Completely eradicating this bacterium has advantages and disadvantages. Therefore, identifying and removing only the malignant strains of Helicobacter pylori is very important for treatment and eradication (36). Epidemiological studies and experiments show that exposure to Helicobacter pylori, especially in childhood, can prevent allergic asthma (37). However, several recent in vivo studies have shown that live bacteria do not play a role in inducing this protective role. Thus, the administration of Helicobacter pylori extract in newborns was able to prevent airway inflammation and goblet cell metaplasia. In this way, the injection of Helicobacter pylori extract can inhibit DCs that are involved in the processing of allergens in the mediastinal lymph nodes of the lungs. And these results show that Helicobacter pylori extract can effectively prevent allergic airway disorders after sensitization (38). H.pylori targets DCs and relies on highly suppressed T-regs. Since HP-NAP is considered as a possible regulator of T-regs and can inhibit the allergic inflammation of asthma, HP-NAP could be developed as an efficient H.pylori -specific vaccine for the treatment of allergic asthma (39, 40, and 41). Van Wyk et al have shown that Helicobacter pylori extract can effectively reduce mucus production and multiple features of inflammation in mice re-challenged by house dust mites (42). Maternal exposure to H.pylori can reduce allergic airway inflammation in offspring via T-regs and also provide new insights for interventional asthma treatment (43). Helicobacter pylori and humans have evolved together for about 50,000 years. This bacterium is the main cause of gastric ulcer, gastric lymphoma and gastric adenocarcinoma. It seems that the complete disappearance of this bacteria has consequences for humans, so that there is now a lot of information about the advantages and disadvantages of this change on the health or disease of the digestive system. However, there is a lot of evidence about its extra intestinal effects, including on allergic asthma. Similar to the inverse association between H.pylori and childhood asthma, H.pylori neutrophil-activating protein (HP-NAP) has the ability to shift allergen-specific T cell responses in vitro from Th-2 responses to Th-1 responses. Also, HP-NAP in the body of mice led to the inhibition of bronchial inflammation in line with Th-2 responses of allergic asthma. (37) Therefore, overall theories support the view that increased prevalence and severity of asthma and allergy in Western countries, it may be related, at least in part, to the reduction of H.pylori infection, which can cause long-term induction of Th1 background and leads to prevention and treatment of asthma and allergic diseases. Since in this research, we have identified the gene of this protein in native bacteria by molecular PCR method, and there is a hope that by extracting and purifying of this protein, it will be used in clinical cases of allergic asthma. Using of this peptide in case with a positive effects in the control and prevention of allergic asthma, the possibility of using it as medicine or vaccine for target patients will be initiated..
Conflict of interest statement
There is no conflict of interest.
References
1. Gonzalo JA, Lloyd CM, Kremer L, Finger E, Martinez-A C, Siegelman MH, et al. Eosinophil recruitment to the lung in a murine model of allergic inflammation. The role of T cells, chemokines, and adhesion receptors. J Clin Invest 1996; 98(10):2332-45.
2. Arnold IC, Dehzad N, Reuter S, Martin H, Becher B, Taube C, et al. Helicobacter pylori infection prevents allergic asthma in mouse models through the induction of regulatory T cells. J Clin Invest 2011; 121(8):3088-93.
3. Kosunen TU, Höök-Nikanne J, Salomaa A, Sarna S, Aromaa A, Haahtela T. Increase of allergen-specific immunoglobulin E antibodies from 1973 to 1994 in a Finnish population and a possible relationship to Helicobacter pylori infections. Clin Exp Allergy 2002; 32(3):373-8.
4. Marshall BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1984; 1(8390):1311-5.
5. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich N, et al. Helicobacter pylori infection and the risk of gastric carcinoma. N Engl J Med 1991; 325(16):1127-31.
6. Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, Isaacson PG. Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet 1991; 338(8776):1175-6.
7. Lankarani KB, Ravanbod MR, Aflaki E, Nazarinia MA, Rajaee A. High prevalence of Helicobacter pylori infection in Behcet's disease. BMC Gastroenterol 2014; 14:58.
8. Fullerton D, Britton JR, Lewis SA, Pavord ID, McKeever TM, Fogarty AW. Helicobacter pylori and lung function, asthma, atopy and allergic disease--a population-based cross-sectional study in adults. Int J Epidemiol 2009; 38(2):419-26.
9. Matricardi PM, Rosmini F, Riondino S, Fortini M, Ferrigno L, Rapicetta M, et al. Exposure to foodborne and orofecal microbes versus airborne viruses in relation to atopy and allergic asthma: epidemiological study. BMJ 2000; 320(7232):412-7.
10. Shiotani A, Miyanishi T, Kamada T, Haruma K. Helicobacter pylori infection and allergic diseases: epidemiological study in Japanese university students. J Gastroenterol Hepatol 2008; 23(7 Pt 2):e29-33.
11. Chen Y, Blaser MJ. Helicobacter pylori colonization is inversely associated with childhood asthma. J Infect Dis 2008; 198(4):553-60.
12. Wang Y, Bi Y, Zhang L, Wang C. Is Helicobacter pylori infection associated with asthma risk? A meta-analysis based on 770 cases and 785 controls. Int J Med Sci 2012; 9(7):603-10.
13. Nyström J, Svennerholm A-M. Oral immunization with HpaA affords therapeutic protective immunity against H.pylori that is reflected by specific mucosal immune responses. Vaccine. 2007; 25(14):2591-8.
14. Amedei A, Cappon A, Codolo G, Cabrelle A, Polenghi A, Benagiano M, et al. The neutrophil-activating protein of Helicobacter pylori promotes Th1 immune responses. J Clin Invest 2006; 116(4):1092-101.
15. Kottakis F, Papadopoulos G, Pappa EV, Cordopatis P, Pentas S, Choli-Papadopoulou T. Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal Region even without dodecamer formation, which is a prerequisite for DNA protection--novel approaches against Helicobacter pylori inflammation. FEBS J 2008; 275(2):302-17.
16. Zanotti G, Papinutto E, Dundon W, Battistutta R, Seveso M, Giudice G, et al. Structure of the neutrophil-activating protein from Helicobacter pylori. J Mol Biol 2002; 323(1):125-30.
17. Del Prete G, Chiumiento L, Amedei A, Piazza M, D'Elios MM, Codolo G, et al. Immunosuppression of TH2 responses in Trichinella spiralis infection by Helicobacter pylori neutrophil-activating protein. J Allergy Clin Immunol 2008; 122(5):908-913.e5.
18. Athari SS, Omidi R. Report of a patient with complex composites of hepatitis B virus, allergic asthma and diabetes. Asian Pac J Trop Biomed 2014; 4(Suppl 1):S59-61.
19. Garcia R, Athari SS. Overview of Relationship of Allergic Asthma with Diet and Food Intake. Journal of food quality and hazards control 2015; 2(1):1-5.
20. Codolo G, Mazzi P, Amedei A, Del Prete G, Berton G, D'Elios MM, et al. The neutrophil-activating protein of Helicobacter pylori down-modulates Th2 inflammation in ovalbumin-induced allergic asthma. Cell Microbiol 2008; 10(11):2355-63.
21. Sudo N, Sawamura S, Tanaka K, Aiba Y, Kubo C, Koga Y. The requirement of intestinal bacterial flora for the development of an IgE production system fully susceptible to oral tolerance induction. J Immunol 1997; 159(4):1739-45.
22. Annagür A, Kendirli SG, Yilmaz M, Altintas DU, Inal A. Is there any relationship between asthma and asthma attack in children and atypical bacterial infections; Chlamydia pneumoniae, Mycoplasma pneumoniae and Helicobacter pylori. J Trop Pediatr 2007; 53(5):313-8.
23. Strachan DP. Hay fever, hygiene, and household size. BMJ 1989; 299(6710):1259-60.
24. Herz U, Lacy P, Renz H, Erb K. The influence of infections on the development and severity of allergic disorders. Curr Opin Immunol 2000; 12(6):632-40.
25. Engler DB, Reuter S, van Wijck Y, Urban S, Kyburz A, Maxeiner J, et al. Effective treatment of allergic airway inflammation with Helicobacter pylori immunomodulators requires BATF3-dependent dendritic cells and IL-10. Proc Natl Acad Sci U S a 2014; 111(32):11810-5.
26. Wohlleben G, Erb KJ. Immune stimulatory strategies for the prevention and treatment of asthma. Curr Pharm Des 2006; 12(25):3281-92.
27. Papadopoulos NG, Konstantinou GN. Antimicrobial strategies: an option to treat allergy? Biomed Pharmacother 2007; 61(1):21-8.
28. Khamechian T, Movahedian AH, Ebrahimi Eskandari G, Heidarzadeh Arani M, Mohammadi A. Evaluation of the Correlation Between Childhood Asthma and Helicobacter pylori in Kashan. Jundishapur J Microbiol 2015; 8(6):e17842.
29. Reibman J, Marmor M, Filner J, Fernandez-Beros ME, Rogers L, Perez-Perez GI, Blaser MJ. Asthma is inversely associated with Helicobacter pylori status in an urban population. PLoS One 2008; 3(12):e4060.
30. Blaser, Martin J et al. “Does Helicobacter pylori protect against asthma and allergy?” Gut 2008; 57(5):561-7.
31. Taube C, Muller A. The role of Helicobacter pylori infection in the development of allergic asthma. Expert Rev Respir Med. 2012;6(4): 441–9.
32. Blaser MJ. The Jeremiah Metzger Lecture:global warming redux: the disappearing microbiota and epidemic obesity. Trans Am Clin Climatol Assoc. 2012; 123: 230–8.
33. Blaser MJ. The theory of disappearing microbiota and the epidemics of chronic diseases.Nat Rev Immunol. 2017; 17(8): 461–3.
34. O’Connor A, O’Morain CA, Ford AC. Population screening and treatment of Helicobacter pylori infection. Nat Rev Gastroenterol Hepatol. 2017; 14(4): 230–40.
35. Yap TW, Leow AH, Azmi AN, Callahan DL,Perez-Perez GI, Loke MF, et al. Global fecal and plasma metabolic dynamics related to Helicobacter pylori eradication. Front Microbiol.2017; 8: 536.
36. Abadi AT, Kusters JG. Management of Helicobacter pylori infections. BMC Gastroenterol.2016; 16(1): 94.
37. Lankarani, K. B., et al. . "The mechanisms underlying Helicobacter pylori-mediated protection against allergic asthma." Tanaffos 2017; 16(4): 251
38. van Wijck Y, de Kleijn S, John-Schuster G,Mertens TCJ, Hiemstra PS, Muller A, et al.Therapeutic application of an extract of Helicobacter pylori ameliorates the development of allergic airway disease. J Immunol.2018; 200(5): 1570–9.
39. Arnold IC, Hitzler I, Muller A. The immunomodulatory properties of Helicobacter pylori confer protection against allergic and chronic inflammatory disorders. Front Cell Infect Microbiol.2012; 2:10.
40. Sehrawat A, Sinha S, Saxena A. Helicobacter pylori neutrophil-activating protein: a potential Treg modulator suppressing allergic asthma? Front Microbiol. 2015; 6:493.
41. D'Elios MM, Andersen LP. Inflammation,immunity, and vaccines for Helicobacter pylori. Helicobacter. 2009; 14(Suppl 1): 21–8.
42. van Wijck Y, John-Schuster G, van Schadewijk A, van den Oever RL, Obieglo K,Hiemstra PS, et al. Extract of Helicobacter pylori ameliorates parameters of airway inflammation and goblet cell hyperplasia following repeated allergen exposure. Int Arch Allergy Immunol. 2019; 180(1): 1–9.
43. Kyburz A, Fallegger A, Zhang X, Altobelli A,Artola-Boran M, Borbet T, et al. Transmaternal Helicobacter pylori exposure reduces allergic airway inflammation in offspring through regulatory T cells. J Allergy Clin Immunol.2019; 143(4): 1496–e11.
