Studying the effect of a swimming training period on NF-κB gene expression in mice with Benzo[a]pyrene -induced lung cancer
الموضوعات : Journal of Physical Activity and HormonesMahnaz Rafati 1 , Elaheh Heidarnia 2 , Mehrzad Moghadasi 3
1 - Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran
2 - Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran
3 - Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran
الکلمات المفتاحية: Lung cancer, Benzo[a]pyrene, Inflammation, NF-κB, Swimming exercises,
ملخص المقالة :
Introduction: NF-κB activation affects hallmarks of cancer and inflammatory diseases through the transcription of genes involved in cell proliferation, survival, angiogenesis, inflammation and tumor promotion and metastasis. This study aimed to investigate the effect of a swimming training session on NF-kB gene expression in mice with benzo[a]pyrene-induced lung cancer.
Material & Methods: In this study, 18 male Balb/c mice (mean age: 8 months; weight: 18–22 g) were divided into 3 groups (healthy control (HC), lung cancer (B[a]P), and lung cancer + training (ST) groups). Lung cancer was induced by an injection of benzo[a]pyrene (B[a]P) (100 mg/kg). The intervention groups received swimming training for 12 weeks, 5 sessions per week. After the 12-week intervention period, lung tissue was dissected and NF-kB gene expression was measured using PCR. Statistical analyses were performed using a one-way analysis of variance followed by Tukey's post-hoc test.
Results: According to one-way variance analysis, there was a significant difference between the study groups in NF-κB gene expression (P = 0.03). To find the location of the difference, the Tukey post-hoc test was used. According to the results of the Tukey post-hoc test, NF-κB gene expression in the HC group was not significantly different from the B[a]P group (P = 0.190). Also, there was no significant difference between the HC group and the ST group (P = 0.526). On the other hand, NF-κB gene expression in the ST group was significantly lower than in the B[a]P group (P = 0.02).
Conclusion: This study shows that ST intervention reduces NF-κB gene expression and improves inflammation in cancerous lung tissue.
1. Xu S, Li J, Yang S, Yang P, Niu Y, Ge Y, Liang G. Effects of benzo[a]pyrene exposure on lung cancer: a mechanistic study of epigenetic m6A levels and YTHDF1. Toxics. 2025;13(4):280. doi:10.3390/toxics13040280.
2. Luo Z, Wan R, Liu S, Feng X, Peng Z, Wang Q, Chen S, Shang X. Mechanisms of exercise in the treatment of lung cancer – a mini-review. Front Immunol. 2023;14:1244764. doi:10.3389/fimmu.2023.1244764.
3. Fashi M, Agha-Alinejad H, Mahabadi HA. The effect of aerobic exercise in ambient particulate matter on lung tissue inflammation and lung cancer. Iran J Cancer Prev. 2015;8(3):e2333. doi:10.17795/ijcp2333.
4. Zhang L, Ludden CM, Cullen AJ, Tew KD, Branco de Barros AL, Townsend DM. Nuclear factor kappa B expression in non-small cell lung cancer. Biomed Pharmacother. 2023;167:115459. doi:10.1016/j.biopha.2023.115459.
5. Park MH, Hong JT. Roles of NF-κB in cancer and inflammatory diseases and their therapeutic approaches. Cells. 2016;5(2):15. doi:10.3390/cells5020015.
6. Kordi MR. The effects of aerobic training on NF-κB, Lin28B, and let-7a microRNA expressions and levels of tumor tissue IL-6 in mice with breast cancer. Sport Physiol. 2015;7(27):119-34.
7. Abekova A, Islamov R, editors. ChemoProtective effects of new iodine coordinated compound in benzo[a]pyrene-induced lung cancer in BALB/c mice. BIO Web Conf. 2024;86:01014. doi:10.1051/bioconf/20248601014.
8. Fei Z, Li D, Li K, Zhou M, Li Y, Li Y, Sun Z. Detraining after tumor-bearing accelerates tumor growth while continuous training decreases tumor growth in mice. J Tradit Chin Med Sci. 2020;7(1):75-81. doi:10.1016/j.jtcms.2020.01.007.
9. Paceli RB, Cal RN, dos Santos CHF, Cordeiro JA, Neiva CM, Nagamine KK, Cury PM. The influence of physical activity in the progression of experimental lung cancer in mice. Pathol Res Pract. 2012;208(7):377-81. doi:10.1016/j.prp.2012.04.002.
10. Ramos D, Olivo CR, Lopes FDTQS, Toledo-Arruda AC, Martins MA, Osório RA, Dolhnikoff M, Ribeiro W, Vieira RP. Low-intensity swimming training partially inhibits lipopolysaccharide-induced acute lung injury. Med Sci Sports Exerc. 2010;42(1):113-9. doi:10.1249/MSS.0b013e3181ad1c72.
11. Arjsri P, Srisawad K, Umsumarng S, Thippraphan P, Anuchapreeda S, Dejkriengkraikul P. Anti-inflammatory and anti-migratory effects of morin on non-small-cell lung cancer metastasis via inhibition of NLRP3/MAPK signaling pathway. Biomolecules. 2025;15(1):103. doi:10.3390/biom15010103.
12. Liu HW, Chang SJ. Moderate exercise suppresses NF-κB signaling and activates the SIRT1-AMPK-PGC1α axis to attenuate muscle loss in diabetic db/db mice. Front Physiol. 2018;9:636. doi:10.3389/fphys.2018.00636.
13. Pavitra E, Kancharla J, Gupta VK, Prasad K, Sung JY, Kim J, Tej MB, Choi R, Lee JH, Han YK, Raju GSR, Bhaskar L, Huh YS. The role of NF-κB in breast cancer initiation, growth, metastasis, and resistance to chemotherapy. Biomed Pharmacother. 2023;163:114822. doi:10.1016/j.biopha.2023.114822.
14. Fashi M, Agha-Alinejad H, Mahabadi HA, Rezaei B, Pakrad BB, Rezaei S. The effects of aerobic exercise on NF-κB and TNF-α in lung tissue of male rat. Nov Biomed. 2015;3(3):131-4.
15. Kapoor G, Prakash S, Jaiswal V, Singh AK. Chronic inflammation and cancer: key pathways and targeted therapies. Cancer Invest. 2025;43(1):1-23. doi:10.1080/07357907.2024.2437614..
|
Physical Activity and Hormones (J Physic Act Horm) Vol. 6 Spring 2025 |
|
Studying the effect of a swimming training period on NF-κB gene expression in mice with Benzo[a]pyrene -induced lung cancer
Mahnaz Rafati1 Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran | Elaheh Heidarnia2 Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran | Mehrzad Moghadasi3 Department of Physical Education and Sports Medicine, Sh.C., Islamic Azad University, Shiraz, Iran |
ABSTRACT
Introduction: NF-κB activation affects hallmarks of cancer and inflammatory diseases through the transcription of genes involved in cell proliferation, survival, angiogenesis, inflammation and tumor promotion and metastasis. This study aimed to investigate the effect of a swimming training session on NF-kB gene expression in mice with benzo[a]pyrene-induced lung cancer.
Material & Methods: In this study, 18 male Balb/c mice (mean age: 8 months; weight: 18–22 g) were divided into 3 groups (healthy control (HC), lung cancer (B[a]P), and lung cancer + training (ST) groups). Lung cancer was induced by injection of benzo[a]pyrene (B[a]P) (100 mg/kg). The intervention groups received swimming training for 12 weeks, 3 sessions per week. After the 12-week intervention period, lung tissue was dissected and NF-kB gene expression was measured using PCR. Statistical analyses were performed using one-way analysis of variance followed by Tukey's post hoc test.
Results: According to the results of one-way analysis of variance, there was a significant difference between the study groups in NF-κB gene expression (P=0.03). To find the location of the difference, Tukey post hoc test was used. According to the results of Tukey post hoc test, NF-κB gene expression in the HC group was not significantly different from the B[a]P group (P=0.190). Also, there was no significant difference between the HC group and the ST group (P=0.526). On the other hand, NF-κB gene expression in the ST group was significantly lower than that in the B[a]P group (P=0.02).
Conclusion: The findings of this study show that ST intervention reduces NF-κB gene expression and thereby improves inflammation in cancerous lung tissue.
Keywords: Lung cancer, Benzo[a]pyrene, Inflammation, NF-κB, Swimming training.
*Correspondence: Heidarnia.elaheh@iau.ac.ir |
Received: Apr 2025; Revised: June 2025; Accepted: Jul 2025.
|
1. Introduction
Benzo(a)pyrene (B[a]P), belonging to the polycyclic aromatic hydrocarbon family, is commonly found in cigarette smoke, food, and atmospheric pollutants. Benzo(a)pyrene-trans-7,8-diol-9,10-epoxide (BPDE), a metabolite of B[a]P, is a well-known mutagen and carcinogen. B[a]P exposure significantly correlates with lung cancer initiation (1). Lung cancer constitutes a formidable menace to global health and well-being, as its incidence and mortality rates escalate alarmingly. According to 2020 worldwide cancer data, lung cancer ranks among the most prevalent malignancies and exhibits the highest mortality rate among all major cancers (2). Environmental agents associated with elevated lung cancer risk, such as ambient particulate matter, may damage the lung by inducing chronic inflammation (3). The pro-inflammatory transcription factor, nuclear factor kappa B (NF-κB) contributes to malignancy by impacting cell senescence, apoptosis, metabolism, stress responses, and tumorigenesis. In adenocarcinoma and squamous cell carcinomas of the lung, NF-κB activation induced by smoking regulates the expression of downstream pathways such as COX-2, cyclin D1, and matrix metalloproteinase-9, thereby promoting cancer cell proliferation and survival (4). In fact, NF-κB activation affects hallmarks of cancer and inflammatory diseases through the transcription of genes involved in cell proliferation, survival, angiogenesis, inflammation and tumor promotion and metastasis (5).
In the realm of lung cancer therapy, exercise has unequivocally proven its efficacy in bolstering the quality of life for patients subjected to arduous treatment modes. A salubrious lifestyle characterized by regular exercise and physical activity is associated with a lower incidence of cancer (including lung cancer) and cancer mortality. Exercise also improves the overall physical condition of cancer patients undergoing chemotherapy or surgery, reducing treatment-related adverse effects and complications (6). Murphy et al. (2011) observed a reduction in tumor volume following aerobic exercise in cancer-bearing mice and attributed this to a decrease in inflammatory factors. A positive feedback loop plays a key role in the transformation of normal cells into cancer cells and cancer progression. NF-KB is a critical component of this loop. In fact, cellular change is initiated by an inflammatory signal that activates NF-ΚB. In fact, NF-ΚB is a key mediator of carcinogenesis caused by inflammation(7).
However, exercise's effects on this key inflammatory factor in cancerous lung tissue have not yet been studied. Therefore, considering the therapeutic effects of exercise, it is necessary to investigate the effect of this therapeutic intervention on NF-κB. Therefore, the present study aimed to investigate the effect of a swimming training session on NF-ΚB gene expression in mice with Benzo[a]pyrene-induced lung cancer.
2. Methodology
2.1. Materials and methods
In this experimental study, a post-test design.
2.2. Participants
In all experiments, the Helsinki’ declaration guidelines for animal care was followed. This study was approved by the Azad Shiraz University. In this experimental study, a post-test design was used, which included 18 male Balb/c mice with an average age of 8 months; weight: 18-22 g. They were divided into 3 groups (healthy control (HC), lung cancer control (Benzo(a)pyrene (B[a]P) induction), and lung cancer + training (ST) group).
2.3. Measurements
Cancer induction: In this study, lung cancer induction was performed using benzo[a]pyrene (B[a]P) (Sigma-Aldrich, Germany). This substance was dissolved in olive oil and injected intraperitoneally (100 mg/kg) into mice. To confirm the induction of lung cancer by B[a]P, first in a pilot study, 6 mice (3 mice injected with B[a]P and 3 healthy mice as controls) were killed after 3 weeks and then the lung tissues were analyzed for tumorigenesis using pathological examinations and the results confirmed lung cancer induction and another 18 mice received B[a]P (8)..
2.4. Intervention
2.4.1 Exercise Protocol (Swimming Training, ST)
Swimming training in this study lasted 12 weeks, with 3 sessions per week, each session lasting from 5 to 38 minutes. Of course, these exercises were not the same throughout the 12 weeks and varied each week. The intensity of the exercise was the same as swimming exercises without weights in the first 4 weeks (9), and weeks 5 to 8 were performed with a tail weight of 2% of body weight, and weeks 9 to 12 and the end of the study were performed with a tail weight of 5% of body weight (9,10). The duration of the exercise was as follows: the first week 5 minutes, the second week 8 minutes, the third week 11 minutes, the fourth week 14 minutes, the fifth week 17 minutes, the sixth week 20 minutes, the seventh week 23 minutes, the eighth week 26 minutes, the ninth week 29 minutes, the tenth week 32 minutes, the eleventh week 35 minutes, and the twelfth week 38 minutes (11).
2.4.2 Tissue collection and analysis
48 hours after the last training session, male Balb/c mice were anesthetized using ketamine: 100 mg/kg; xylazine: 10 mg/kg, and lung tissue was isolated and stored at -80°C. Total RNA extraction was performed using FavorPrep™ Tissue Total RNA Kit (FATRK 001, Taiwan). NF-κB mRNA was then measured by real-time PCR and calculated by the [A1] ΔΔCt method.
Table 1. Primers used in the study
Gene | Primer sequences | Size (bp) |
NF-κB | Forward: 5’- GCTGCCAAAGAAGGACACGACA -3’ | 131 |
| Reverse: 5’- GGCAGGCTATTGCTCATCACAG -3’ |
|
Fig 1. Representative pictures of H&E-stained lung sections. A. lung in the control group; B. lung in the B[a]P group. Arrowheads indicate tumors. Images acquired at ×100 magnification and scale bars represent 1 mm
2.5. Statistical Methods
Data were analyzed by a one-way ANOVA followed by Tukey's post-hoc test (SPSS v25). A significance level of p < 0.05 was considered for all statistical analyses, indicating the threshold for determining statistically significant results.
3. Results
Table 2. The result of comparison of NF-ΚB between research groups
| Sum of Squares | df | Mean Square | F | Sig. |
Between Groups | 8.956 | 2 | 4.478 | 4.435 | 0.03 |
Within Groups | 15.145 | 17 | 1.010 |
|
|
Total | 24.101 | 17 |
|
|
|
According to the results of one-way analysis of variance (Table 1), there was a significant difference between the study groups in NF-κB gene expression (P = 0.03). To find the location of the difference, the Tukey post hoc test was used (Figure 1). According to the results of the Tukey post hoc test, NF-κB gene expression in the HC group was not significantly different from the B[a]P group (P = 0.190). Also, there was no significant difference between the HC group and the ST group (P = 0.526). On the other hand, NF-κB gene expression in the ST group was significantly lower than in the B[a]P group (P = 0.02).
Figure 2. Figure 1. Comparison of NF-κB gene expression between research groups (* Difference between BZP and ST groups (P = 0.02))
4. Discussion
The present study investigated the effect of a swimming training period on NF-ΚB gene expression in mice with benzo[a]pyrene-induced lung cancer. Inflammation is a key factor in cancer development, initiating tumorigenesis but also promoting progression (12). In fact, the nuclear factor-κB (NF-κB) family of transcription factors control the expression of genes involved in many critical physiological responses such as inflammatory responses (5). Research has shown that moderate exercise reduces NF-κB gene expression and suppresses inflammatory factors (13). Results of this study showed that NF-κB in the HC group, despite being lower than in the B[a]P group, did not differ significantly. There was also no significant difference between the HC group and the ST group. On the other hand, there was a significant difference between the B[a]P and ST groups. This significant difference indicated an improvement in NF-B reduction in the ST group. Therefore, according to this study, 12 weeks of swimming training reduced this inflammatory factor in the lung tissue of B[a]P-induced cancer mice. NF-κB plays an essential role in the management of inflammation, proliferation, and survival of cell lines.NF-κB is a superfamily of TFs discovered in 1986 which includes NF-κB 1 (p50) NF-κB (p52), ReIA (p65), ReIB, and C-ReI.NF-κB is present in the cytoplasm as an inactive form by complexing with inhibitory subunits IΚB-α, -β and -ϒ.The dissociation of inhibitory subunits (IκB s) results in the activation and rapid translocation of NF-κB heterodimer into the nucleus to bind with DNA. The subunit p65 then displays its transcriptional activity and induces the expression of NF-κB target genes that inhibit apoptosis, and forms a network that regulates the cell cycle, and promotes cell invasiveness, inflammation, tumorigenesis, metastasis, and eventually resistance to radio- and chemotherapy (14). Fashi et al. (2015) evaluated aerobic exercise's effect on lung inflammation. The results showed that aerobic exercise inhibits the expression of NF-κB and TNF-α genes (15) which was consistent with this study. Luo et al (2023), in a study investigating the mechanisms through which exercise exerts its anti-cancer effects against lung cancer, showed that in terms of prevention, exercise can reduce the risk of lung cancer. Exercise suppresses inflammatory responses, enhances immune function, regulates cellular autophagy, and decreasing oxidative stress. The results of this study were also consistent with the results of this study that ST reduced NF-κB in the lung tissue of mice with lung cancer (16). Therefore, given that the available evidence suggests persistent inflammation and cancer in various organs. Also, impairment of inflammatory responses in tumors occurs due to inadequate proinflammatory mediators. Therefore, inhibition of the excessive or abnormal production of proinflammatory mediators is one of the predicted effects of chemopreventive phytochemicals. A specific subset of proinflammatory mediators facilitates the neoplastic transformation of cells in an abnormal microenvironment created by chronic inflammation (17). In this study, ST reduced B[a]P-induced NF-κB.
5. Conclusion
This study shows that ST intervention reduces NF-κB gene expression and improves inflammation in cancerous lung tissue. ST counteracts cancer effects by reducing NF-κB expression, highlighting their potential as anti-cancer therapies.
6. Acknowledgment
The researchers hereby thank and appreciate all those who contributed to this research.
Conflict of interests: The authors declare that there is no conflict of interest regarding the publication of this manuscript.
References
1. Xu S, Li J, Yang S, Yang P, Niu Y, Ge Y, Liang G. Effects of benzo[a]pyrene exposure on lung cancer: a mechanistic study of epigenetic m6A levels and YTHDF1. Toxics. 2025;13(4):280. doi:10.3390/toxics13040280.
2. Luo Z, Wan R, Liu S, Feng X, Peng Z, Wang Q, Chen S, Shang X. Mechanisms of exercise in the treatment of lung cancer – a mini-review. Front Immunol. 2023;14:1244764. doi:10.3389/fimmu.2023.1244764.
3. Fashi M, Agha-Alinejad H, Mahabadi HA. The effect of aerobic exercise in ambient particulate matter on lung tissue inflammation and lung cancer. Iran J Cancer Prev. 2015;8(3):e2333. doi:10.17795/ijcp2333.
4. Zhang L, Ludden CM, Cullen AJ, Tew KD, Branco de Barros AL, Townsend DM. Nuclear factor kappa B expression in non-small cell lung cancer. Biomed Pharmacother. 2023;167:115459. doi:10.1016/j.biopha.2023.115459.
5. Park MH, Hong JT. Roles of NF-κB in cancer and inflammatory diseases and their therapeutic approaches. Cells. 2016;5(2):15. doi:10.3390/cells5020015.
6. Kordi MR. The effects of aerobic training on NF-κB, Lin28B, and let-7a microRNA expressions and levels of tumor tissue IL-6 in mice with breast cancer. Sport Physiol. 2015;7(27):119-34.
7. Abekova A, Islamov R, editors. ChemoProtective effects of new iodine coordinated compound in benzo[a]pyrene-induced lung cancer in BALB/c mice. BIO Web Conf. 2024;86:01014. doi:10.1051/bioconf/20248601014.
8. Fei Z, Li D, Li K, Zhou M, Li Y, Li Y, Sun Z. Detraining after tumor-bearing accelerates tumor growth while continuous training decreases tumor growth in mice. J Tradit Chin Med Sci. 2020;7(1):75-81. doi:10.1016/j.jtcms.2020.01.007.
9. Paceli RB, Cal RN, dos Santos CHF, Cordeiro JA, Neiva CM, Nagamine KK, Cury PM. The influence of physical activity in the progression of experimental lung cancer in mice. Pathol Res Pract. 2012;208(7):377-81. doi:10.1016/j.prp.2012.04.002.
10. Ramos D, Olivo CR, Lopes FDTQS, Toledo-Arruda AC, Martins MA, Osório RA, Dolhnikoff M, Ribeiro W, Vieira RP. Low-intensity swimming training partially inhibits lipopolysaccharide-induced acute lung injury. Med Sci Sports Exerc. 2010;42(1):113-9. doi:10.1249/MSS.0b013e3181ad1c72.
11. Arjsri P, Srisawad K, Umsumarng S, Thippraphan P, Anuchapreeda S, Dejkriengkraikul P. Anti-inflammatory and anti-migratory effects of morin on non-small-cell lung cancer metastasis via inhibition of NLRP3/MAPK signaling pathway. Biomolecules. 2025;15(1):103. doi:10.3390/biom15010103.
12. Liu HW, Chang SJ. Moderate exercise suppresses NF-κB signaling and activates the SIRT1-AMPK-PGC1α axis to attenuate muscle loss in diabetic db/db mice. Front Physiol. 2018;9:636. doi:10.3389/fphys.2018.00636.
13. Pavitra E, Kancharla J, Gupta VK, Prasad K, Sung JY, Kim J, Tej MB, Choi R, Lee JH, Han YK, Raju GSR, Bhaskar L, Huh YS. The role of NF-κB in breast cancer initiation, growth, metastasis, and resistance to chemotherapy. Biomed Pharmacother. 2023;163:114822. doi:10.1016/j.biopha.2023.114822.
14. Fashi M, Agha-Alinejad H, Mahabadi HA, Rezaei B, Pakrad BB, Rezaei S. The effects of aerobic exercise on NF-κB and TNF-α in lung tissue of male rat. Nov Biomed. 2015;3(3):131-4.
15. Kapoor G, Prakash S, Jaiswal V, Singh AK. Chronic inflammation and cancer: key pathways and targeted therapies. Cancer Invest. 2025;43(1):1-23. doi:10.1080/07357907.2024.2437614..
I.A.U (Shiraz Campus) Page 0 https://sanad.iau.ir/journal/jpah/
