The effect of rs7008740 and rs11987254 polymorphisms in MYBL1 gene and its effect on male infertility in Fars province-Iran
الموضوعات : Report of Health Care
1 - Biology Department of Islamic Azad University, Arsanjan Branch
الکلمات المفتاحية: Polymorphism, Men Infertility, mybl1 gene,
ملخص المقالة :
Introduction: Infertility is defined by the failure to reach a clinical pregnancy after one year of unprotected sexual intercourse, and often 15% of couples are infertile. Male factor solely and partially contributes to about 20% and 50% of infertilities, respectively. Both environmental and genetic factors play important roles in infertility, and the mybl1 gene and its polymorphisms are well known in this case. This study was going to evaluate whether rs7008740 and rs11987254 polymorphisms in mybl1 gene have a significant relationship with the risk of male infertility in Fars province or not.
Materials and methods: This study involved 100 infertile men and 100 fertile men (control group). The Tetra-ARMS PCR and ARMS PCR techniques were used to detect mybl1 polymorphism genotypes.
Results: The results showed that rs7008740 and rs11987254 polymorphisms in mybl1 gene did not have a significant relationship with the risk of male infertility in this population (P>0.05). However, there was a significant relationship between family history and infertility (P <0.001).
Conclusion: This study indicated that rs7008740 and rs11987254 polymorphic loci in mybl1 gene did not have a significant relationship with the risk of male infertility.
The effect of rs7008740 and rs11987254 polymorphisms in MYBL1 gene and its effect on male infertility in Fars province-Iran
Abstract
Introduction: Infertility is defined by the failure to reach a clinical pregnancy after one year of unprotected sexual intercourse, and often 15% of couples are infertile. Male factor solely and partially contributes to about 20% and 50% of infertilities, respectively. Both environmental and genetic factors play important roles in infertility, and the mybl1 gene and its polymorphisms are well known in this case. This study was going to evaluate whether rs7008740 and rs11987254 polymorphisms in mybl1 gene have a significant relationship with the risk of male infertility in Fars province or not.
Materials and methods: This study involved 100 infertile men and 100 fertile men (control group). The Tetra-ARMS PCR and ARMS PCR techniques were used to detect mybl1 polymorphism genotypes.
Results: The results showed that rs7008740 and rs11987254 polymorphisms in mybl1 gene did not have a significant relationship with the risk of male infertility in this population (P>0.05). However, there was a significant relationship between family history and infertility (P <0.001).
Conclusion: This study indicated that rs7008740 and rs11987254 polymorphic loci in mybl1 gene did not have a significant relationship with the risk of male infertility.
Keywords: men infertility, mybl1 gene, polymorphism.
Introduction
Male infertility is defined by male's inability to cause pregnancy in a fertile female, involves 40–50% of infertility in humans, and occurs in approximately 7% of all men (1). The semen is analyzed at the first step of the male infertility evaluation and then patients are divided into various groups including normospermia, oligospermia, asthenospermia, teratospermia, leukocytospermia, azoospermia, or a combination of these (2). Previous studies showed that fertility and the quality of semen have declined over the past decade (3). Semen analysis alone is insufficient to adequately evaluate the infertile male and further research is needed to discover diagnostic methods for male infertility in the future (4).
Recent studies show that male infertility has been increasing in Iran, its rate is faster than that in the world, and it involves 10% of men (5). Some factors such as bacterial infection, oxidative stress, varicocele (an excessive dilation of vessels of the pampiniform plexus), antidepressants, and smoking can play a role in accelerating infertility in men (6).
Infertility is generally divided into primary and secondary infertility. Primary infertility is defined by the inability to conceive after at least 12 months of unprotected intercourse. Secondary infertility is used for couples who cannot get pregnant after previously giving birth. The patterns of infertility in developing countries are quite different from those in developed countries, and the incidence of preventable infertility in developing countries is very high (7).
In addition to environmental factors, some causes of infertilities originate from genetic and epigenetic factors. Previous extensive research in this field showed that the malfunction of hundreds of genes related to somatic and sexual chromosomes can lead to infertility, including ESR1, ESR2, FSHR, PRM1, PRM2, and AMYB (8).
The mybl1 gene, encoding a protein known as AMYB and A-MYB, is mainly expressed in the lymph nodes and testicles, as well as in 15 other tissues. The gene contains 18 exons, its locus was mapped on the long arm of chromosome 8 (8q13.1), and the orientation of transcription of this gene and the chromosome is the reverse (9). A master regulator of male meiosis and contribution to the cell cycle are the roles of mybl1 transcription factor (10). As a transcription factor, the main role of MYB family proteins is to participate in the proliferation and differentiation of nerve cells, spermatogenic cells, and lymphocyte B cells. Abnormalities and defects in sperm production are seen in mice with the silenced A-MYB gene (11).
The polymorphic variants of this gene can directly affect the sexual activity and thus male fertility. This study aimed to evaluate whether rs7008740 and rs11987254 polymorphisms in mybl1 gene have a significant relationship with the risk of male infertility in Fars province and can be considered a biomarker for this disease or not.
Materials and methods
This research was a case-control study and evaluated 200 men, including 100 men with infertility (approved by a specialist) and 100 fertile men (control) with at least one child and no diagnosed fertility disorder. The control and patient groups were matched for age (±5.5 years). Blood samples of patients were obtained from Dr. Neshat laboratory, Shiraz, Iran, and control blood samples were obtained from the Shiraz Blood Transfusion Organization with the permission of the university. After obtaining patient consent, blood samples (5 mL) were taken, collected in tubes containing EDTA, and transferred to the laboratory along with a questionnaire containing demographic information. Blood samples were stored in a freezer at -20 ˚C until further experiments for the genotype detection.
The salting-out method was used to extract DNA from peripheral blood. After designing primers using NCBI PRIMER BLAST Approach, a partial sequence of the mybl1 gene was amplified using the ARMS technique (Table 1). The genotype was detected using gel electrophoresis and gel documentation system (Gel Doc).
Table 1: Primers used in the Tetra ARMS PCR and ARMS PCR
Sequence (5' to 3') | Primers | Gene polymorphism |
TGCAGTGAGTCAGGGTCATTTAGTG TGCAGTGAGTCAGGGTCATTTAGTC TGGACAAGGACTTTAGGTATTTGAA GGGAGGTAGAGGGGTGATGT GAGATTCAGTGTGGTGGGGG | FI (C allele): FII (G allele): Common R GAPDH F GAPDH R | mybl1 rs7008740 (C/G) |
CACTGCACTCCAGCATGGGGAATAGCGT TTGTTGTTTTTTTTTTGAGACTAGGTCGCG GCCTGTAGTCCCAGCTACTTTGGAGGCTG AGAGAGAAGCTTGCATGCACTGCTGTCA | FI (T allele): RI (C allele): FO RO | mybl1 rs11987254 (A/G)
|
The relationship between different factors and the risk of male infertility was analyzed using a logistic regression analysis and the computation of odds ratios (OR) with a 95% confidence interval (CI). The significance level was defined at P<0.05. The t-test was used to compare means in SPSS software ver. 19.
Results
In this study, the age range and average age of the individuals were 23-43 and 32.6 ± 5.3 years old, respectively. The average age in the infertile group and fertile group was 32.5±9.3 and 32.5± 2.3, respectively, indicating no significant difference (P<0.3) in age between the two groups.
Table 2 shows the relationship between possible risk factors (e.g. smoking and family history) and the susceptibility to male infertility, analyzed using logistic regression analysis and the computation of OR with 95% CI. The results showed a significant relationship between family history and male infertility (P <0.001), while smoking did not show a significant relationship with this disease (P = 0.72).
Table 2. The effect of some risk factors on the susceptibility to male infertility
Risk factor | Control (n) | Patient (n) | P | OR (95% CI) |
Smoking | 82 | 80 |
|
|
No smoking | 18 | 20 | 0.72 | 1.14 (0.2-56.31) |
History of infertility | 83 | 62 |
|
|
No infertility history | 17 | 38 | 0.001* | 2.9 (1.5-5.8) |
The ARMS PCR technique was used to detect single-nucleotide polymorphism rs7008740 genotypes (GG, CG, and CC) in the MYBL1 gene. After binding the primer to the leading strand of DNA and its replication by the ARMS PCR, two fragments with 257 bps and 744 bps were observed. If the tube containing allele C would show fragments with 744 and 257 bps and the tube containing allele G display 744 bps, it was the CC genotype. On the other hand, if the tube containing allele C would show 744 bp fragment, and the tube containing allele G would show fragments with 744 and 257 bps, it was GG genotype. Finally, if each tube would show both fragments, the genotype was CG. Figure 1 shows the results of detecting single-nucleotide polymorphism rs7008740 genotypes (GG, CG, and CC) in the MYBL1 gene
Fig. 1: Detection of rs7008740 genotypes in the MYBL1 gene.
The genotype distribution of polymorphisms rs7008740 did not show a deviation from the Hardy Weinberg equilibrium in two control (P = 0.2, df=1, χ2=1.2) and patient (P = 0.7, df=1, χ2=0.2) groups. Moreover, this study evaluated the effect of three genetic models of this polymorphism, namely dominant, co-dominant, and recessive, on the risk of this disease (Table 3). In this case, CC genotype was considered as the reference and the effect of other genotypes on the risk was measured compared to this reference. There was no significant relationship between these genotypes and the risk of male infertility. However, in terms of allele, a significant relationship was observed between the allele G and male infertility.
Table 3: The relationship between rs7008740 polymorphism and the risk of male infertility
rs7008740 | Control (n%) | Patient (n%) | OR (95% CI)* | P value | |
Genotype | GG | 6 (6%) | 7 (7%) | 1.3 (0.4-4.2) | 0.6 |
CG | 29 (29%) | 36 (36%) | 1.4 (0.2-8.6) | 0.2 | |
CC | 65 (65%) | 57 (57%) | - | - | |
Allele | G | 41 | 50 | 1.3 (0.2-8.1) | 0.2 |
C | 159 | 150 | - | - | |
*Logistic regression analysis before moderating data based on age. P< 0.5 was considered in this experiment.
The Tetra-ARMS PCR technique was used to detect single-nucleotide polymorphism rs11987254 genotypes (GG, AG, and AA) in the MYBL1 gene. After binding the primer to the leading strand of DNA and its replication by the Tetra-ARMS PCR, three fragments with 199 bps (allele A), 132 bps (allele G), and 273 bps (internal control) appeared on agarose gel (3%). While AA genotype showed 2 fragments with 199 bps and 273 bps, the AG genotype showed three fragments with 199 bps, 132 bps, and 273 bps on the agarose gel (fig. 2).
Figure 2. Detection of rs11987254 genotypes in MYBL1 gene.
The genotype distribution of polymorphism rs11987254 showed a deviation from the Hardy Weinberg equilibrium in control (P = 0.002, df=1, χ2=9.8) but did not show this deviation in the patient group (P = 0.8, df=1, χ2=0.02). Moreover, this study evaluated the effect of three genetic models of this polymorphism, namely dominant, co-dominant, and recessive, on the risk of this disease (Table 4). In this case, the AA genotype was considered as the reference and the effect of other genotypes on the risk was measured compared to this reference. There was no significant relationship between these genotypes or even alleles and the risk of male infertility.
Table 4: The relationship between rs11987254 polymorphism and the risk of male infertility
Rs11987254 | Control (n%) | Patient (n%) | OR (95% CI)* | P-value | |
Genotype | AA | 95 (95) | 97 (97) | - | - |
AG | 4 (4) | 3 (3) | 0.73 (0.3-2.4) | 0.7 | |
GG | 1 (1) | 0 (0) | 0.000 | 1 | |
Allele | A | 194 | 197 | - | - |
G | 6 | 3 | 0.5 (0.1-1.9) | 0.3 | |
*Data were moderated based on the age. P<0.05 was considered for this experiment.
Discussion and conclusion
About 8 to 12% of couples are childless, 35% of infertility is related to male infertility, and both males and females contribute to 25% of this disorder. Infertility and its individual and social problems are an important issue for couples; because it is recognizable in 40% of cases. Infertility treatment is more difficult in men, especially in developing countries than in women. Therefore, the identification of genetic factors involving in infertility can play an important role in better understanding the etiology of this complication (12).
The present study evaluated the effect of rs7008740 and rs11987254 polymorphisms in mybl1 gene on male infertility. The results showed that there was no significant relationship between the genotypes of these polymorphic loci and the disease in this population. However, family relationships showed a more significant association with this disorder compared to the other risk factors.
There are some contradictory reports about the effects of smoking on male infertility. Qahramani et al. (2005) reported that smoking duration did not have a significant effect on the morphology and motility of sperm. However, they reported that smoking led to a significant reduction in the number of sperm (800000 sperms) after one year (13). Nevertheless, the present study showed that there was no significant relationship between smoking and an increased risk of infertility.
Moreover, Farkhondeh et al. (2012) evaluated the relationship between smoking and the risk of infertility in 130 infertile men and found that smoking decreases` sperm motility and the percentage of sperm with normal morphologic features, thereby affecting infertility in men (14).
Takahashi et al. (1995) found that the transcription of mybl1 gene is often carried out in testicles and peripheral blood leukocytes (15). Toscani et al. (1997) reported that proto-oncogene A-myb (mybl1) is essential for the process of meiosis in men, and its elimination leads to the cessation of sperm formation in the pachytene stage (16).
Tang et al. (2012) evaluated the mechanism of action of the mybl1 gene in mice and hypothesized that mybl1 would lead to specific activation of primary spermatocyte (17). It has been demonstrated that the mybl1 gene takes part in spermatogenesis and the evaluation of its polymorphisms could help identify markers that affect male infertility. However, the present study indicated that rs7008740 and rs11987254 polymorphisms in mybl1 gene did not have a significant relationship with the risk of male infertility. Nevertheless, its other polymorphisms may be associated with male infertility and need to be evaluated by other researchers.
Acknowledgment
This article was extracted from a master's thesis. Hereby, we would like to thank for the cooperation of the specialized staff in the Iranian Novin Gene Laboratory and all the colleagues participating in this research project.
Conflict of interest: there is no conflict of interest.
References
1. Guzick D, Swan S. The decline of infertility: apparent or real? Fertility and sterility. 2006;86(3):524-6; 34.
2. Schuppe HC, Meinhardt A, Allam JP, Bergmann M, Weidner W, Haidl G. Chronic orchitis: a neglected cause of male infertility? Andrologia. 2008;40(2):84-91.
3. Lopez Teijon M, Garcia F, Serra O, Moragas M, Rabanal A, Olivares R, et al. Semen quality in a population of volunteers from the province of Barcelona. Repro bio online. 2007;15(4):434-44.
4. Lanzafame FM, La Vignera S, Vicari E, Calogero AE. Oxidative stress and medical antioxidant treatment in male infertility. Repro bio online. 2009;19(5):638-59.
5. Hosseini J, Imad_al-Din M, Mokhtarpour H, Surani M. Prevalence of primary and secondary infertility in four selected provinces in Iran, 2010-2011. Obstet Gynecol Infertil J. 2012; 15.
6. Agarwal A, Allamaneni S. Free radicals and male reproduction. J Indian Med Assoc. 2011; 109:184-7.
7. Mahboubi M, Ghahramani F. The effect of smoking on the sperm and male infertility. J Kerman Uni Med Scien. 2013; 17: 294-99.
8. Zini A, San Gabriel M, Baazeem A. Antioxidants and sperm DNA damage: a clinical perspective. JARG. 2009;26 (8):427-432.
9. Barletta C, Druck T, LaForgia S, Calabretta B, Drabkin H, Patterson D, Croce C, Huebner K. Chromosome locations of the MYB related genes, AMYB and BMYB. Cancer Res. 1991; 51: 3821-3824.
10. Bolcun E, Bannister L, Barash A, Schimenti K, Hartford S, Eppig J, et al. A-MYB (MYBL1) transcription factor is a master regulator of male meiosis. Develop. 2011; 138(15): 3319–3330.
11. Li SF, Iacuone S, Parish RW (2007) Suppression and restoration of male fertility using a transcription factor. Plant Biotechnol J 5:297–312
12. Bayasgalan G, Naranbat D, Radnaabazar J, Lhagvasuren T, Rowe PJ. Male infertility risk factors in Mongolian men. Asian J Androl 2004; 6:305-11.
13. Ghahremanei F, Ghaem H. The effective factors on men infertility: a case – control study. J Gorgan Uni Med Sci. 2005; 7: 42-45.
14. Farkhunda N, Amin F, Saira B. Effects of cigarette smoking on male fertility. Turk J Med Sci. 2012; 42 (2): 1400-1405.
15. Takahashi T, Nakagoshi H, Sarai A, Nomura N, Yamamoto T, Ishii S. Human A-myb gene encodes a transcriptional activator containing the negative regulatory domains. FEBS Lett. 1995; 358(1):89-96.
16. Toscani A, Mettus R, Coupland R, Simpkins H, Litvin J, Orth J, et al. Arrest of spermatogenesis and defective breast development in mice lacking A-myb. Nature. 1997; 386, 713-717.
17. Tang H, Goldberg E. A-MYB (MYBL1) stimulates murine testis-specific Ldhc expression via the cAMP-responsive element (CRE) site. Biol Reprod. 2012; 86: 30.
